Genotype Frequencies of Polymorphic GSTM1, GSTT1, and Cytochrome P450 CYP1A1 in Mexicans

Genotype Frequencies of Polymorphic GSTM1, GSTT1, and Cytochrome P450 CYP1A1 in Mexicans

Montero, Regina

Abstract

The genotype frequencies of three metabolic polymorphisms were determined in a sample of a typical community in central Mexico. CYP1A1*3, GSTM1, and GSTT1 polymorphisms were studied in 150 donors born in Mexico and with Mexican ascendants; with respect to ethnicity the subjects can be considered Mestizos. PCR reactions were used to amplify specific fragments of the selected genes from genomic DNA. An unexpected 56.7% frequency of the CYP1A1*3 allele (which depends on the presence of a Val residue in the 462 position of the enzyme, instead of Ile) was found, the highest described for open populations of different ethnic origins (i.e., Caucasian, Asian, African, or African American). The GSTM1 null genotype was found with a frequency of 42.6%, which is not different from other ethnicities, whereas the GSTT1 null genotype had a frequency of 9.3%, one of the lowest described for any ethnic group but comparable to the frequency found in India (9.7%). The frequency of the combined genotype CYP1A1*3/*3 and the GSTM1 null allele is one of the highest observed to date (or perhaps the highest): 13.7% among all the ethnicities studied, including Caucasians and Asians, whereas the combination of CYP1A1*3/*3 with the GSTT1 null allele reached only 2.8%. The GSTM1 null allele combined with the GSTT1 null allele, on the other hand, has one of the lowest frequencies described, 4.24%, comparable to the frequencies found in African Americans and Indians. Finally, the combined CYP1A1*3/*3, GSTM1 null allele, and GSTT1 null allele genotype could not be found in the sample studied; it is assumed that the frequency of carriers of these combined genotypes is less than 1%. CYP1A1*3 and CYP1A1*2 polymorphisms were also evaluated in 50 residents in a community of northern Mexico; the CYP1A1*3 frequency was 54%, similar to that found in the other community studied, and the CYP1A1*2 frequency was 40%, which is high compared to Caucasians and Asians but comparable to the frequency found in Japanese and lower than the frequency found in Mapuche Indians. Haplotype frequencies for these CYP1A1 polymorphisms were estimated, and a linkage disequilibrium value (D) of 0.137 was calculated.

KEY WORDS: CYP1A1, GSTM1, GSTT1, GENOTYPE AND ALLELE FREQUENCIES IN MEXICO, MEXICAN MESTIZOS, POLYCYCLIC AROMATIC HYDROCARBON (PAH), CANCER RISK.

Metabolic polymorphisms in humans have been related to individual susceptibility to cancer in ecogenetic studies (Hayashi et al. 1991; Nakachi et al. 1993; Kihara et al. 1995; Fryer and Jones 1999; Chen et al. 2001; Hung et al. 2003). Identifying these polymorphisms in molecular epidemiology has become a common practice to determine allele frequencies in different ethnic groups and to establish potential relationships with genotoxic damage resulting from specific exposures to chemical agents (Abdel-Rahman et al. 1998; Pavanello and Clonfero 2000; Montero et al. 2003).

Polycyclic aromatic hydrocarbons (PAHs) are some of the most ubiquitous contaminants in the world, because they are present in urban air pollution or anywhere that fossil fuels are burned; they are present in tobacco smoke and affect both active and passive smokers, and they also constitute an occupational hazard for workers in the coke-oven industry.

Metabolic polymorphisms of enzymes related to the bioactivation of PAHs have been extensively studied in numerous works aimed at estimating the health risks resulting from exposure to those compounds, particularly cancers of the respiratory tract (Nebert et al. 2004). Furthermore, genotoxicity also results from the exposure to PAHs, for instance, elevated levels of PAH-DNA adducts were associated with exposure to tobacco smoke (Poirier et al. 2000; Georgiadis et al. 2001, 2004) and elevated micronuclei frequencies were found in cytokinesis blocked lymphocytes of coke-oven workers (Leng et al. 2004). PAHs undergo biotransformation by xenobiotic metabolizing systems that result either in their elimination after conjugation with water-soluble molecules or the generation of derivatives that are able to react with biologically critical molecules, such as DNA or proteins. Thus genetic polymorphisms of the enzymes involved in the biotransformation of toxicants may play an important role in an individual’s susceptibility to adverse health effects resulting from exposure to environmental pollution containing PAHs. Even though several cytochrome P450 (CYP) isoforms participate in PAH metabolism, CYPlAl seems to be the most important isoform involved in the phase I bioactivation of these compounds (Bonvallot et al. 2001; Ma 2001; Baumetal. 2001).

In addition, several phase II conjugating enzymes participate in the detoxification of PAHs, and most of these proteins also display polymorphism in human populations (Alexandrie et al. 2000; Y. Kim et al. 2003; Pavanello et al. 2005). Schoket et al. (2001) found increased genotoxic damage in individuals who carry the GSTM1 null allele. Schoket and colleagues reported increased DNA adducts in aluminum smelter workers who carry the GSTM1 null allele. Leng et al. (2004) found elevated micronuclei frequencies in cytokinesis blocked lymphocytes of coke-oven workers who carried the GSTM1 null allele and also had high microsomal epoxide hydrolase (mEH) activity. Numerous other studies have reported increased cancer risk or increased genotoxic damage resulting from the lack of this enzyme; for example, GSTM1-null polymorphism has been found to increase the frequency of chromosome aberrations after tobacco-specific N-nitrosamine exposure in vitro (Salama et al. 1999). Other studies have shown that the GSTM1-null genotype in combination with the CYP1A1*3 allele increases the susceptibility to PAH exposure-associated cancer (Wan et al. 2002; Hirvonen et al. 1993; Lazarus et al. 1998).

Trihalomethanes, formed during the process of water chlorination, constitute a health hazard when biotransformed into active metabolites capable of damaging DNA; GSTT1 has been identified as the enzyme responsible for that activation (Ross and Pegram 2004). Colombo et al. (2004) found that GSTM1 and GSTT1 positive genotypes were associated with increased risk of disease, where these genotypes were more frequent among patients with chronic gastritis.

Most studies, however, describe associations of different tumors with GSTM1 and GSTT1 null genotypes, and GSTT1 has been studied mainly in association with GSTM1 or other metabolic polymorphisms. An example is an Italian study about gastric cancer in which a completely opposite result to that of Colombo et al. (2004) was found, pointing to GSTM1-null and GSTT1-null as the risk genotypes (Palli et al. 2005). The two null genotypes also conferred greater susceptibility to prostate cancer among Indians in a study by Srivastava et al. (2005). The deletion of both genes was also associated with cervical cancer and with papillomavirus infection (Joseph et al. 2006). With respect to occupational exposure to PAHs, workers with the GSTT1 null genotype showed higher 1-hydroxy-pyrene metabolite levels in urine compared to GSTT1 positive individuals (Bisceglia et al. 2005).

Because of their importance in processes leading to DNA damage and eventually to cancer, we determined the frequency of CYP1A1, GSTM1, and GSTT1 polymorphisms in the Mexican population. This estimation of polymorphism frequency is necessary because differences among ethnic groups have been described, particularly for CYPlA1*3; despite CYP1A1*3 being considered a risk factor for lung cancer, it has been found at very low frequency in Caucasian populations (3%); on the other hand, CYP1A1*3 is of importance for Japanese groups because of its high frequency in that population (20-25%) (Garte et al. 2001). According to Garte (1998), the frequency for Latin American populations should be somewhere in between these values, as was suggested by the 16% frequency found in a group of Hispanics studied in the United States without identification of nationality or ethnic origin.

In the present study individuals of Mexican origin were chosen. The inclusion criterion was that they should be descendants of parents and grandparents born in Mexico. Individuals were studied for CYP1A1*3, GSTM1-null, and G.STT1-null genetic polymorphisms. The genotype frequencies of each polymorphism and then the frequency of genotype combinations were determined. Forty of the donors had been studied for CYP1A1*2 polymorphism, thus giving us the opportunity to analyze the linkage frequency of both CYP1A1 polymorphisms.

Materials and Methods

Individuals Studied. One hundred fifty unrelated individuals in the states of Tlaxcala and Puebla were accepted to participate in the study; they were descendants of parents and grandparents born in Mexico. Eighty-one participants were female, and 69 were male. Blood samples (3 ml) were taken to isolate DNA and were used to determine CYP1A1*3, GSTM1-null, and GSTT1 -null polymorphisms as well as the association frequencies among them. All donors were Mestizos.

Fifty DNA samples from unrelated male donors from Coahuila were used to determine CYP1A1*3 polymorphism; CYP1A1*2 polymorphism had already been determined in 40 of these donors. These samples were used to determine the haplotype frequencies for these polymorphisms.

DNA Extraction. A Bio-Rad AquaPure Genomic DNA Blood Kit (Bio-Rad, Hercules, California) was used to extract DNA from each frozen blood sample, and the method followed was the manufacturer’s instructions, including RNase treatment.

CYP1A1*3 Polymorphism (Ile/Val Polymorphism in Exon 7). The nomenclature used for CYPlAl polymorphisms was taken from Pavanello and Clonfero (2000), Garte and Crosti (1999), and Garte (1998). The CYP1A1 gene is located on chromosome 15; it is composed of seven exons and seven introns and has a large number of known polymorphisms.

This polymorphism involves an A [arrow right] G transition at nucleotide 4889 in exon 7 of CYP1A1. The transition causes an amino acid change in position 462 of the CYP1A1 protein, Ile462Val (Hayashi et al. 1991). The polymorphism can be identified by digestion with the BsrDI restriction enzyme (New England BioLabs, B everly, Massachusetts) (Cascorbi et al. 1996). The restriction recognition sequence (5′-NN^CATTGC-3′) exists in the CYP1A1*1 allele, where A is the nucleotide present. The CYP1A1*3 allele carries a G in that position and is therefore refractory to digestion by BsrOI. We used an RFLP method to detect this polymorphism, because the use of specific primers for each allele resulted in many false-positive wild-type alleles. Hence we designed a PCR that amplified a large fragment of CYP1A1 exon 7 by using primer EX7 (5′-GAAAGGCTGGGTCCACCCTCT-5′) (sequence taken from Hirvonen et al. 1992) and primer OJA10 (57prime;-TCAGAGGC CTAAGGACCTCCTAACC-3′), which is complementary to a sequence 760-bp downstream, inside exon 7.

PCR reactions were processedin a Mastercycler Gradient thermocycler (Eppendor, Hamburg, Germany) and contained 2 mM MgCl^sub 2^, 0.6 U of Taq polymerase, 0.2 µM of each primer, and 0.120 mM dNTPs in a final volume of 25 µl. The amplification program consisted of denaturation for 3 min at 94°C, followed by 30 cycles at 94°C for 30 s, 60°C for 60 s, and 72°C for 45 s, and a final extension at 72°C for 3 min. The 760-bp amplification fragment was digested with BsrDI enzyme (MBI Fermentas, Hanover, Maryland). The product was visualized by electrophoresis in a 3% agarose gel, stained with ethidium bromide. All PCR reagents, including primers, were purchased from Life Technologies (Frederick, Maryland).

CYP1A1*2 Polymorphism (MspI PolymorpMsm). CYP1A1 *2, located in the 3′ noncoding region of the gene and caused by a T [arrow right] C transition at nucleotide 6235, had been previously determined in 40 donors, according to Hayashi et al. (1991). The primer sequences used were 5′-TAGGAGTCTTGTCTCATGCCT-S’ and 5′-CAGTGAAGAGGTGTAGCCGCT-3′. The 340-bp products were digested for 16 hr at 37°C with Mspl in a volume of 15 µl (New England BioLabs, Beverly, Massachusetts). The digestion products were analyzed in 2% agarose gels: One 340-bp band was indicative of a homozygous wild-type allele (ml/ml); 200- and 140-bp bands corresponded to homozygote mutant (m2/m2) and 340-, 200-, and 140-bp bands denoted a hétérozygote (m1/m2).

GSTM1-Null Polymorphism. The method describedby Hirvonen et al. (1993) was used to determine the presence or absence of the GSTM1 gene. A PCR was conducted with primers amplifying the ex on 4 and ex on 5 regions of the GSTM1 gene, located on chromosome 1, along with a specific primer to amplify a sequence of the closely related gene, GSTM4, which is always present. The primer sequences were GSTMFW (5′-CGCCATCTTGTGCTACATTGCCCG-3′), GSTMRV (5′-AT CTTCTCCTCTTCTGTCTC-3′), and GSTM1REV (5′-TTCTGGATTGTAGCAG ATCA-3′). The GSTM1REV primer is specific for GSTM1, whereas the GSTMRV primer amplifies GSTM4. The PCR was conducted in 200 -µM reactions containing 2 µM MgCl2, 0.4 U of Taq polymerase, 0.3 µM primer FW, 0.2 µM primer RV, 0.5 µM primer REV, and 0.15 mM dNTPs. The cycling conditions were denaturation at 94°C for 3 min, followed by 30 cycles of 94°C for 30 s, 60°C for 45 s, and 72°C for 45 s, and a final extension at 72°C for 2 min. Genotypes were determined in 1% agarose gels by the presence or absence of 231-bp bands; GSTM4 appeared as a 158-bp band.

GSTT1-Null PolymorpMsm. GSTT1 amplification was done according to the method of Pemble et al. (1994) and was coamplified with a beta-globin gene sequence taken from Bell and Pittman (1997). The GSTT1 gene is located on chromosome 22. The following primers were used: GSTT1 forward primer (5′-TT CCTTACTGGTCCTCACATCTC), GSTT1 reverse primer (5′-TCACCGGATCA TGGCCAGCA), beta-globin forward (5′-CAACTTCATCCACGTTCACC), and beta-globin reverse primer (5′-GAAGAGCCAAGGACAGGTAC). The PCR was conducted in 200 -µM reactions containing 2 mM MgCl^sub 2^, 0.4 U of Taq polymerase, 1.0 µM primer GSTTFW, and 1.0 µµ primer GSTTRV; beta-globin primers were used in 0.5 µM concentration and 0.15 mM dNTPs. The cycling conditions were denaturation at 94°C for 4 min, followed by 30 cycles at 94°C for 20 s, 62°C for 30 s, and 72°C for 45 s, and a final extension at 72°C for 4 min. Genotypes were determined by the presence or the absence of a 480-bp band in a 1% agarose gel; beta-globin appeared at 270-bp size.

Statistical Analysis. Chi-square analysis was used to test for Hardy-Weinberg equilibrium of CYP1A1 alleles.

Results

CYP1A1*3 polymorphism was determined in two different geographic regions: the Carboniferous zone in the northern state of Coahuila, and a rural area in the boundaries of the states of Tlaxcala and Puebla in the central part of Mexico. Genotype and allele frequencies in both localities were not significantly different, although the Val allele had a higher frequency in Tlaxcala-Puebla than in Coahuila: 56.7% versus 54.0%, respectively (Table 1). The genotype frequencies were in Hardy-Weinberg equilibrium in both localities (chi-square, 2 df, p > 0.05).

Forty donors from Coahuila had previously been studied for the CYP1A1*2 polymorphism. The frequency of CYP1A1*2 alleles (Mspl polymorphism) was 60% for ml and 40% for m^sup 2^. Genotype frequencies were 32.5% for m1/m1, 55% for m1/m2, and 12.5% for m2/m2, and they were also distributed according to Hardy-Weinberg equilibrium (p > 0.05; Table 2). Combined genotypes of CYP1A1*2 and CYP1A1*3 polymorphisms in these 40 individuals are presented in Table 3. From this table the frequencies of He -m1, Val-m1, Ile -m2, and Val-m2 were calculated and weighted by the observed gene frequencies: Ile = 0.5 and Val = 0.5. The frequencies obtained are shown in the bottom part of Table 3, where Ile-m1 and Val-m2 were the most frequent combinations: 0.425 and 0.35, respectively. Val-m1 had a frequency of 0.15, and Ile-m2 had a frequency of 0.075. Linkage disequilibrium between the two loci was then calculated according to the formula D =h – p^sub 1^p^sub 2^ (Vogel and Motulsky 1997), and a value of 0.137 was found.

The samples taken in Tlaxcala-Puebla were used to determine CYP1A1*3, as already mentioned, and the GSTM1-null and GSTT1-null polymorphisms. GSTM1null reached a frequency of 42.6%, whereas the GSTT1 null frequency was 9.3% (Table 4).

Frequencies for combined genotypes were calculated for CYP1A1*3 plus GSTM1; CYP1A1*3 plus GSTT1; all three genotypes, CYP1A1*3 plus GSTM1 plus GSTT1; and GSTM1 plus GSTT1. Results are presented in Tables 5-8.

Discussion

The CYP1A1 polymorphisms studied here exhibited elevated frequencies, which were higher than those reported for the Hispanic population in the United States. CYP1A1*2 (or the m2 allele) showed a frequency of 40%, which is higher than those reported for Caucasians, Asians, Africans, and even Latin Americans studied in the United States and Europe (Garte 1998). Our CYP1A1*2 allele frequency, however, is lower than the 83% reported for Mapuche Indians from Chile (Munozetal. 1998).

The frequencies of 54% and 56.7% found for the Val allele of CYP1A1*3 in the present study are also the highest reported in groups of Mestizos. Caspar et al. (2002) reported a frequency of 12-15% in Brazilians with African ancestry and suggested that this allele could have originated in Africa, despite that it has not been found in studies with Africans, as reported by Garte (1998). In contrast, Kvitko et al. (2000) reported a frequency of 54-97% in Brazilian indigenous groups. Populations in the different regions of Mexico have an important genetic component of indigenous origin. Thus the fact that frequencies of 54.0% and 56.7% were found in the groups studied suggests that in Amerindian groups the CYP1A1*3 allele might have gone through a founder effect after the original migrations from Asia, reaching in American populations frequencies higher than those observed in other continents, with the highest frequencies being found in South America, namely, Brazil and Chile. Hence the origin of this mutation is more probably Asia rather than Africa. It would be interesting to analyze this polymorphism in the Amerindian groups of Canada and the United States to establish whether the frequencies of the m2 and Val alleles are lower in these groups. Contrary to common belief, CYP1A1*3 frequency is not midway between modern Asian and Caucasian populations, as was suggested by Garte (1998), and the same is true about the frequency of the GSTT1 null allele. Also, it would be expected that other genes relevant to diseases would have gone through the same founder effect, resulting in increased frequencies among Amerindian groups.

The frequency of the combined CYP1A1 genotypes allowed us to calculate the haplotype frequency and thus to evaluate how linkage disequilibrium of these alleles behaved in our population. We compared these haplotype frequencies with those reported by Hayashi et al. (1991) for a Japanese population, and they were significantly different (chi-square p

No surprises were found with respect to GSTM1 polymorphism. We determined that the GSTM1-null genotype was present with a frequency of 45%. Coughlin and Hall (2002), in a review of this polymorphism, found that the GSTM1-null genotype frequency ranges from 23% to 48% in African populations, from 33% to 63% in Asian populations, and from 39% to 62% among Europeans. It should be noted that the frequency found in Tlaxcala-Puebla is higher than 39.2%, which is the frequency we have determined among residents in Mexico City (data not shown); nevertheless, both frequencies are high and in the range of the frequencies determined for other ethnic groups, thus suggesting an old origin of this polymorphism in human populations.

The GSTT1-null genotype showed a frequency of 9.3% among our donors, lower than frequencies reported in Asian populations (Yang et al. 2005), which range from 20% to 53%, and lower than frequencies reported in Caucasian populations, which range from 16% to 22% (Geisler and Olshan 2001). The frequency found here is in agreement with the frequency reported by Nelson et al. (1995) for a group of Mexican Americans, 9.7%. To our knowledge this is the first report of GSTT1 polymorphism frequency in Mexico.

With respect to combined frequencies of these polymorphisms, CYP1A1*3 in the homozygous form (Val/Val) in combination with GSTM1-null. was found with a frequency of 13.7%, which is very high compared to the frequencies reported for Chinese (3.7%) (Ng et al. 2005), Caucasians (3.9%) (Hung et al. 2003), and Indians (0.9%) (Chacko et al. 2005). This combination was associated with increased lung cancer risk and breast cancer susceptibility in the cited studies. According to these results, given the high frequency of the CYP1A1*3 polymorphism in Mexican populations and consequently of the combined frequency of this polymorphism with the GSTM1-null allele, we would expect that a larger fraction of individuals would be extraordinarily susceptible to lung and breast cancer. Investigations should be done to confirm this hypothesis.

Ng et al. (2005) reported a CYP1A1 Val/Val and GSTT1-null combined frequency of 2.5% in healthy Chinese individuals, and this combination was also associated with increased lung cancer risk among nonsmokers. This frequency is similar to 2.8% found in the present study.

Despite the high frequency of the CYP1A1 Val/Val and GSTMl-null genotypes, we were not able to find individuals carrying the three susceptible genotypes, that is, those having the GSTT1-null genotype in addition to the CYP1A1 Val/Val and GSTM1-null genotypes. In fact, the combination of GSTM1-null and GSTT1-null genotypes was very low, only 4.24%, compared to frequencies reported by Garte et al. (2001) for Caucasians and Asians (10.4% and 24.6%, respectively), by Aras et al. (2005) for Turkish individuals (9.3%), and by S. Kim et al. (2004) for Koreans (20%). African Americans, on the other hand, exhibited low frequencies of this combination too, as reported by Cote et al. (2005) (5.13%) and Wenzlaff et al. (2005) (0.0%); furthermore, Indians, in a study by Sreeja et al. (2005), also had a low frequency (3.42%) of this combination.

The combination of GSTM1-null and GSTT1-null has been related to increased aneuploidy resulting from benzene exposure (S. Kim et al. 2004), to transverse or rectal tumors (Aras et al. 2005), to lung cancer (Sreeja et al. 2005), and to lung cancer among nonsmokers exposed to environmental tobacco smoke, whether they were Caucasian or African American (Wenzlaff et al. 2005; Cote et al. 2005). As can be seen, despite the relatively low frequencies of these combinations, researchers have been able to establish increased risk of cancer for individuals carrying them. It should be kept in mind that 4.24% in a population of millions would signify a considerable number of people who might need attention for some type of cancer in the future, given the fact that it is becoming likely that they will be exposed to either tobacco smoke or environmental contaminants (PAHs) during their lives.

To conclude, CYP1A1*3 polymorphism is more frequent in the Mexican population than it is in Caucasians, Asians, and African Americans. A low frequency of the GSTT1-null genotype was found, which is similar to the frequency reported for South Indians and is much lower than the frequencies reported for other Asians, Caucasians, and African Americans. The GSTMl-null genotype, on the other hand, showed frequencies comparable to all other ethnic groups studied to date.

Acknowledgments We thank Johny Ponce for his technical work. The present study was supported by the Universidad Nacional Autonoma de Mexico through grant PAPIITIN220506.

Received 6 September 2006; revision received 24 January 2007.

Literature Cited

Abdel-Rahman, S. Z., R. A. El-Zein, J. B. Zwischenberger et al. 1998. Association of the NAT1*10 genotype with increased chromosome aberrations and higher lung cancer risk in cigarette smokers. Mutat. Res. 398:43-54.

Alexandrie, A. K., M. Warholm, U. Carstenesen et al. 2000. CYPlAl and GSTMl polymorphisms affect urinary 1-hydroxypyrene levels after PAH exposure. Carcinogenesis 21:669-676.

Aras, N., L. Tamer, C. Ates et al. 2005. Glutathione S-transferase Ml, Tl, P1 genotypes and risk for development of colorectal cancer. Biochem. Genet. 43(3-4): 149-163.

Baum, M., S. Amin, F. P. Guengerich et al. 2001. Metabolic activation of benzo[c]phenanthrene by cytochrome P450 enzymes in human liver and lung. Chem. Res. Toxicol. 14:686-693.

Bell, D., and G. Pittman. 1997. Genotype analysis. In PCR Protocols in Molecular Toxicology, J. P. Vaden Heuvel, ed. Orlando, FL: CRC Press, 172-175.

Bisceglia, L., G. de Nichilo, G. Elia et al. 2005. Assessment of occupational exposure to PAH in coke-oven workers of Taranto steel plant through biological monitoring. Epidemiol. Prev. 29(5-6, suppl.):37-41 (in Italian).

Bonvallot, V., A. Baeza-Squiban, A. Bauliget al. 2001. Organic compounds from diesel exhaust particles elicit a proinflammatory response in human airway epithelial cells and induce cytochrome p450 IAl expression. Am, J. Respir. Cell Mol. Biol. 25:515-521.

Cascorbi, L, J. Brockmoller, andl. Roots. 1996. A C4887A polymorphism in exon 7 of human CYP1A1: Population frequency, mutation linkages, and impact on lung cancer susceptibility. Cancer Res. 56:4965-4969.

Chacko, P, T. Joseph, B. Mathew et al. 2005. Role of xenobiotic metabolizing gene polymorphisms in breast cancer susceptibility and treatment outcome. Mutat. Res. 581:153-163.

Chen, S., K. Xue, L. Xu et al. 2001. Polymorphisms of the CYPlAl and GSTM1 genes in relation to individual susceptibility to lung carcinoma in Chinese population. Mutat. Res. Genomics 458:41-47.

Colombo, J., A. R. Rossit, A. Caetano et al. 2004. GSTT1, GSTM1, and CYP2E1 genetic polymorphisms in gastric cancer and chronic gastritis in a Brazilian population. World J. Gastroenterol. 10(9):1240-1245.

Cote, M., S. Kardia, A. Wenzlaff et al. 2005. Combinations of glutathione S-transferase genotypes and risk of early-onset lung cancer in Caucasians and African Americans: A population-based study. Carcinogenesis 26(4):811-819.

Coughlin, S., andl. Hall. 2002. Glutathione S-transferase polymorphisms and risk of ovarian cancer: A HuGE review. Gen. Med. 4:250-257.

Fryer, A., and P Jones. 1999. Interactions between detoxifying enzyme polymorphisms and susceptibility to cancer. InMetabolic Polymorphisms and Susceptibility to Cancer, P Vineis, N. Malats, M. Lang et al., eds. IARC Scientific Publications 148. Lyon, France: International Agency for Research on Cancer, 303-321.

Garte, S. 1998. The role of ethnicity in cancer susceptibility gene polymorphism: The example of CYP1A1. Carcinogenesis 19:1329-1332.

Garte, S. F, and F. Crosti. 1999. A nomenclature system for metabolic gene polymorphisms. In Metabolic Polymorphisms and Susceptibility to Cancer, P Vineis, N. Malats, M. Lang et al., eds. IARC Scientific Publications 148. Lyon, France: International Agency for Research on Cancer, 5-12.

Garte, S., L. Gaspari, A. Alexandire et al. 2001. Metabolic gene polymorphism frequencies in control populations. Cancer Epidemiol. Biomark. Prev. 10:1239-1248.

Caspar, P A., K. Kvitko, L. G. Papadopolis et al. 2002. High frequency of CYPlAl *2C allele in Brazilian populations. Hum. Biol. 74(2):235-242.

Geisler, S. A., and A. F Olshan. 2001. GSTMl, GSTTl, and the risk of squamous cell carcinoma of the head and neck: Amini-HuGE review. Am. J. Epidemiol. 154(2): 98-105.

Georgiadis, P, N. A. Demopoulos, J. Topinka et al. 2004. Impact of phase I or phase II enzyme polymorphisms on lymphocyte DNA adducts in subjects exposed to urban air pollution and environmental tobacco smoke. Toxicol. Lett. 149:269-280.

Georgiadis, P., J. Topinka, M. Stoikidouet al. 2001. Biomarkers of genotoxicity of air pollution (the AULIS project): Bulky DNA adducts in subjects with moderate to low exposures to airborne polycyclic aromatic hydrocarbons and their relationship to environmental tobacco smoke and other parameters. Carcinogenesis 22:1447-1457.

Hayashi, S., J. Watanabe, K. Nakachi et al. 1991. Genetic linkage of lung cancer-associa ted Mspl polymorphisms with amino acid replacement in the heme-binding region of the human cytochrome P4501A1 gene. 7. Biockem. 110:407-411.

Hirvonen, A., K. Husgafvel-Pursiainen, S. Anttilaet al. 1993. The GSTM1-null genotype as a potential risk modifier for squamous cell carcinoma of the lung. Carcinogenesis 14:1479-1481.

Hirvonen, A., K. Husgafvel-Pursiainen, A. Karjalainen et al. 1992. Point-mutational Mspl and Ile/Val polymorphisms closely linked in the CYPlAl gene: Lack of association with susceptibility to lung cancer in a Finnish study population. Cancer Epidemiol. Biomark. Prev. 1:485-489.

Hung, R. J., P. Boffetta, J. Brockmoller et al. 2003. CYPlAl and GSTM genetic polymorphisms and lung cancer risk in Caucasian nonsmokers: A pooled analysis. Carcinogenesis 24(5):875-882.

Joseph, T., P. Chacko, R. Wesley et al. 2006. Germline genetic polymorphisms of CYPlAl, GSTMl, and GSTTl genes in Indian cervical cancer: Associations with tumor progression, age, and human papillomavirus infection. Gynecol. Oncol. 101(3):411-417.

Kihara, M., M. Kihara, and K. Noda. 1995. Risk of smoking for squamous and small cell carcinomas of the lung modulated by combinations of CYPlAl and GSTMl gene polymorphisms in a Japanese population. Carcinogenesis 16(10):2331-2336.

Kim, S., J. Choi, Y. Cho et al. 2004. Chromosomal aberrations in workers exposed to low levels of benzene: Association with genetic polymorphisms. Pharmacogenetics 14:453-463.

Kim, Y. D., C. H. Lee, H. M. Nan et al. 2003. Effects of genetic polymorphisms in metabolic enzymes on the relationships between 8-hydroxydeoxyguanosine levels in human leukocytes and urinary 1-hydroxypyrene and 2-naphthol concentrations. J. Occup. Health 45:160-167.

Kvitko, K., J. C. B. Nunes, T. A. Weimer et al. 2000. Cytochrome P4501A1 polymorphisms in South American Indians. Hum. Biol 72(6):1039-1043.

Lazarus, P., S. N. Sheikh, Q. Ren et al. 1998. p53, but not p16 mutations in oral squamous cell carcinomas are associated with specific CYPlAl and GSTMl polymorphic genotypes and patient tobacco use. Carcinogenesis 19:509-514.

Leng, S., Y Dai, Y Niu et al. 2004. Effects of genetic polymorphisms of metabolic enzymes on cytokinesis-block micronucleus in peripheral blood lymphocyte among coke-oven workers. Cancer Epidemiol. Biomark. Prev. 13:1631-1639.

Ma, Q. 2001. Induction of CYPlAl : The AhR/DRE paradigm-Transcription, receptor regulation, and expanding biological roles. Curr. Drug Metab. 2:149-164.

Montero, R., L. Serrano, V. DáVila et al. 2003. Metabolic polymorphisms and the micronucleus frequency in buccal epithelium of adolescents living in an urban environment. Environ. Mol. Mutagen. 42:216-222.

Muñoz, S., V. Vollrath, M. P. Vallejos et al. 1998. Genetic polymorphisms of CYP2D6, CYPlAl, and CYP2E1 in the South Amerindian population of Chile. Pharmacogenetics 8:343-351.

Nakachi, K., K. Imai, S. Hayashi et al. 1993. Polymorphisms of the CYPlAl and glutathione Stransferase genes associated with susceptibility to lung cancer in relation to cigarette dose in a Japanese population. Cancer Res. 53:2994-2999.

Nebert, D. W., T. P. Dalton, A. B. Okey et al. 2004. Role of aryl hydrocarbon receptor-mediated induction of the CYP1 enzymes in environmental toxicity and cancer. J. Biol. Chem. 279(23) :23,847-23,850.

Nelson, H. H., J. K. Wiencke, D. C. Christiani et al. 1995. Ethnic differences in the prevalence of the homozygous deleted genotype of glutathioneS-transferase theta. Carcinogenesis 16:1243-1245.

Ng, D., K. Tan, B. Zhao et al. 2005. CYPlAl polymorphisms and risk of lung cancer in nonsmoking Chinese women: Influence of environmental tobacco smoke exposure and GSTM1/T1 genetic variation. Cancer Causes and Control 16:399-405.

Palli, D., C. Saieva, S. Gemma et al. 2005. GSTT1 and GSTM1 gene polymorphisms and gastric cancer in a high-risk Italian population. Int. J. Cancer 115(2):284-289.

Pavanello, S., and E. Clonfero. 2000. Biological indicators of genotoxic risk and metabolic polymorphisms. Mutat. Res. 463:285-308.

Pavanello, S., A. Pulliero, E. Siwinska et al. 2005. Reduced nucleotide excision repair and GSTM1-null genotypes influence anti-B[a]PDE-DNA adduct levels in mononuclear white blood cells of highly PAH-exposed coke oven workers. Carcinogenesis 26(1):169-175.

Pemble, S., K. R. Schroeder, S. R. Spencer et al. 1994. Human glutathione S-transferase theta (GSTT1): cDNA cloning and the characterization of a genetic polymorphism. Biockem. J. 300:271-276.

Poirier, M., R. Santella, and A. Weston. 2000. Carcinogen macromolecular adducts and their measurement. Carcinogenesis 21:353-359.

Ross, M. K., and R. A. Pegram. 2004. In vitro bio transformation and genotoxicity of the drinking water disinfection byproduct bromodichloromethane: DNA binding mediated by glutathione transferase theta 1-1. Toxicol. Appl. Pkarmacol. 195:166-181.

Salama, S. A., S. Z. Abdel-Rahman, C. H. Sierra-Torres et al. 1999. Role of polymorphic GSTM1 and GSTT1 genotypes on NNK-induced genotoxicity. Pharmacogenetics 9:735-743.

Schoket, B., G. Papp, K. Levay et al. 2001. Impact of metabolic genotypes on levels of biomarkers of genotoxic exposure. Mutat. Res. 482:57-69.

Sreeja, L., V. Syamala, S. Hariharan et al. 2005. Possible risk modification by CYP1A1, GSTM1, and GSTT1 gene polymorphisms in lung cancer susceptibility in a South Indian population. J. Hum. Genet. 50:618-627.

Srivastava, D. S., A. Mandhani, B. Mittal et al. 2005. Genetic polymorphism of glutathione S-transferase genes (GSTM1, GSTT1, and GSTP1) and susceptibility to prostate cancer in northern India. BJU Int. 95(1):170-173.

Vogel, E, and A. G. Motulsky. 1997. Human Genetics. Problems and Approaches. New York: Springer Verlag.

Wan, J., J. Shi, L. Hui et al. 2002. Association of genetic polymorphisms in CYP2E1, MPO, NQO1, GSTM1, and GSTT1 genes with benzene poisoning. Environ. Health Perspect. 110(12): 1213-1218.

Wenzlaff, A., M. Cote, C. Socket al. 2005. GSTM1, GSTT1, and GSTP1 polymorphisms, environmental tobacco smoke exposure, and risk of lung cancer among never smokers: A population-based study. Carcinogenesis 26(2):395-401.

Yang, C.-X., K. Matsuo, Z.-M. Wang et al. 2005. Phase I/II enzyme gene polymorphisms and esophageal cancer risk: Ameta-analysis of the literature. World J. Gastroenterol. 11(17) :2531-2538.

REGINA MONTERO,1 ANTONIO ARAUJO,1 PALOMA CARRANZA,1 VANESSA MEJÍALOZA,2 LUIS SERRANO,1 ARNULFO ALBORES,2 JUAN E. SALINAS,3 AND RAFAEL CAMACHO-CARRANZA1

1 Instituto de Investigaciones Biomédicas, Universidad Nacional Autónoma de México, PO Box 70228, Mexico City 04510, Mexico.

2 Sección Externa de Centro de Investigación y Estudios Avanzados, Instituto Politécnico Nacional (CINVESTAV-IPN), Mexico City, Mexico.

3 Jurisdicción Sanitaria No. 3, Secretaría de Salud, Sabinas, Coah, Mexico.

Human Biology, June 2007, v. 79, no. 3, pp. 299-312.

Copyright © 2007 Wayne State University Press, Detroit, Michigan 48201-1309

Copyright Wayne State University Press Jun 2007

Provided by ProQuest Information and Learning Company. All rights Reserved