Protein tyrosine phosphatase 1B reduction regulates adiposity and expression of genes involved in lipogenesis

Protein tyrosine phosphatase 1B reduction regulates adiposity and expression of genes involved in lipogenesis

Cristina M. Rondinone

Protein tyrosine phosphatases play an important role in the regulation of insulin signal transduction, and a number of protein tyrosine phosphatases have been reported to regulate insulin receptor (IR) signaling both under normal conditions and in the insulin-resistant state (1-3). PTP1B has been shown to serve as a negative regulator of IR and IR substrate (IRS)-1 phosphorylation (4,5). In addition, several studies have demonstrated that increased expression of PTP1B occurs in insulin-resistant states associated with obesity (6,7). Mice lacking a functional PTP1B gene exhibit increased insulin sensitivity in liver and skeletal muscle but fall to show increased insulin sensitivity in fat. They are resistant to weight gain on a high-fat diet (8) and are reported to have low adiposity due to a marked reduction in fat cell mass without a decrease in adipocyte number (9). The reason for the obesity resistance observed in PTP1B-/- mice is unclear. Increased leptin sensitivity in PTP1B-/- mice has been suggested as a mechanism for increased energy expenditure (9). Although these reports demonstrate a major role of PTP1B in the modulation of insulin sensitivity in liver and muscle, they fail to address the effect of reducing PTP1B expression in adipose tissue in obese diabetic animals.

Recently, we have investigated the effects of PTP1B antisense (ISIS-113715) treatment on insulin resistance and the regulation of insulin signaling in ob/ob diabetic mice. Interestingly, hyperglycemic ob/ob mice as well as db/db mice treated with the PTP1B antisense oligonucleotide (ASO) displayed a significant reduction in blood glucose and insulin levels that correlated with a decrease in PTP1B protein expression in liver and fat (10). To determine the effects of reducing PTP1B levels in fat of insulin-resistant hyperglycemic obese (ob/ob) mice, these animals were treated with the PTP1B ASO and fat was analyzed for changes in proteins involved in insulin signaling and insulin sensitivity after an insulin challenge. We also used a cDNA microarray approach to study gene expression in fat from ob/ob mice treated with the PTP1B ASO. Genes involved in lipid metabolism and lipogenesis were influenced by the reduction of PTP1B in fat. In rodents, elevated lipogenesis plays a crucial role in the overproduction of fat. It is well known that hypertrophied adipose depots of animals in which obesity results from the disruption of the leptin signaling pathway (such as ob/ob and db/db mice and fa/fa rats) exhibit disregulated lipogenesis that cannot be normalized by nutritional or pharmacological treatments (11). One of the transcription factors that has been shown to regulate the expression of several key genes of fatty acid and triglyceride metabolism is sterol regulatory element-binding protein (SREBP)1 (12). The family of SREBP-responsive genes, first limited to the LDL receptor and genes involved in cholesterol synthesis, has been expanded to include several additional genes that control lipid metabolism, such as fatty acid synthase (FAS) (13), acetyl-CoA carboxylase (14), glycerol-3-phosphate acyltransferase (15), leptin (16), and lipoprotein lipase (LPL) (17), which are important for adipose tissue metabolism. SREBPs have also been implicated in the enlargement of adipocyte energy stores and obesity (13).

In this study, we show a decrease in adiposity in animals treated with the PTP1B ASO that correlated with a down-regulation of SREBP1 and other lipogenic genes, suggesting that PTP1B reduction in fat might have a primary role in inhibiting lipogenesis and the development of obesity in these animals.

Interestingly, no increase in insulin-stimulated protein kinase B (PKB) phosphorylation in fat was detected in these animals, although an increase in IRS-2 protein as well as a differential regulation of phosphatidylinositol (PI) 3-kinase splice variants were observed.

RESEARCH DESIGN AND METHODS

Identification of ASO inhibitors. Rapid throughput screens for identifying ASO inhibitors selective against PTP1B were performed with 20-base chimeric ASOs in which the first and ]as[ five bases had a 2′-0-(2-methoxy)-ethyl (2’MOE) modification (18). The 2’MOE modification increases binding affinity to complementary RNA sequences anti increases resistance to nuclei. These ASOs also have a phosphorothiorate backbone and use an RNase H-dependent mechanism for activity. Initial screens were conducted against rat PTP1B, and 10 ASOs were identified as hits, “all of which targeted a similar binding site within the coding region of file PTP1B mRNA. Subsequently, a series of in vitro characterization experiments were performed in primary rat anti mouse hepatocytes, in which ISIS-113715 was consistently identified to be the most potent and specific oligonucleotide in reducing PTP1B mRNA levels. ISIS-113715 hybridizes to PTP1B mRNA at nucleotides 862-882 in the coding sequence.

Animal care and treatments. Six- to seven-week-old ob/ob mice (Jackson Laboratories, Bar Harbor, ME) were acclimated to the animal research facilities for 5 days. The following investigations were conducted in accordance within Institutional Animal Care and Use Committee guidelines. Animals were housed and maintained on mouse diet (ob/ob Labdiets 5015; Labdiets, St. Louis, MO) ad libitum.

After acclimation, the ob/ob mice were weighed and tail-snip glucose levels were determined by the glucose oxidase method (Precision G glucose meter; Abbott Laboratories, North Chicago, IL) The animals were randomized to the various treatment groups based on plasma glucose levels and body weight. Baseline plasma insulin samples were taken from a subset of the animals representing each treatment group once randomized (n = 10 ob/ob and n = 10 lean littermates) (ELISA [enzyme-linked immunosorbent aasay]: ALPCO Diagnostics, Windham, NH). Six-week treatment groups (n = 10/treatment) were 25, 2.5, and 0.25 mg/kg ob/ob PTP1B ASO and saline. All mice were dosed twice per week intraperitoneally. At the end of each week, tail bleed glucose and insulin (ob/ob only) levels as well as body weight were determined under nonfasting conditions by 10:00 A.M. (as described above). At the end of the studies, epididymal fat pads were frozen immediately in liquid nitrogen for further analysis.

Insulin challenge. Insulin (2 units]kg in 0.1% BSA) or saline control was given intraperitoneally after an overnight fast. Tissue samples from fat (0, 1, and 5 min) were taken under both saline and insulin-stimulated conditions (n = 4/treatment/time point). Subgroups of saline- or antisense-treated (25 mg/kg) mice were within each challenge (saline and insulin).

Fat triglyceride content. The triglyceride content of fat pads was measured as previously described (19).

Tissue extract preparation and Immunobloting techniques. Tissues were sonicated (using a Branson 450 Sonifier) in lysis buffer containing 20 mmol/l Tris * HCl (pH 7.4). 1% Triton X-100, 10% glycerol, 150 mmol/l NaCl, 2 mmol/] EDTA, 25 mmol/l [beta]-glycerophosphate, 20 mmol/l sodium flouride, 1 mmol/l sodium orthovanadate, 2 mmol/l sodium pyrophosphate, 10 [micro]g/ml leupeptin, 1 mmol/l benzamidine, 1 mmol/l 4-(2-aminoethyl) benzenesulfonyl fluoride hydrochloride, and 1 mmol/l microcystin and rocked for 40 min at 4[degrees]C Detergent-insoluble material was sedimented by centrifugation at 12,000y for 10 min at 4[degrees]C. Cell lysate proteins (50 [micro]g protein) were separated by SDS/PAGE on 10 and 7.5% gels. Proteins were transferred from the gel to nitrocellulose sheets and blocked in 5% milk. The blots were probed with various primary antibodies &s follows: anti-PTP1B, anti-IRS-1 (PH domain), anti-IRS-2, anti-p85 (whole antiserum), anti-phosphotyrosine antibodies (Upstate Biotechnology, Lake Placid, NY), anti-IR[beta] antibody (Transduction Laboratories. San Diego, CA), and phospho-PKB antibody (New England Biolabs, Beverly, MA) according to the recommendations of the manufacturer. The proteins were detected by enhanced chemiluminescence with horseradish peroxidase-labeled secondary antibodies (Amersham, Piscataway, N J). The intensity of the bands was quantified with a laser densitometer (Molecular Dynamics, Sunnyvale, CA).

RNA preparation. RNA was prepared by grinding ~100 mg fat tissue in 1 ml TRIzol reagent, and analysis was done according to the Affymetrix (Santa Clara, CA) protocol. Briefly, the RNA from four mice in PTP1B ASO-treated or control groups was pooled using equal amounts, making a total of 20 [micro]g RNA. cRNA was prepared using the Superscript Choice system from Gibco BRL Life Technologies (Rockville, MD) (cat. no. 18090-019). The protocol was followed with the exception that the printer used for the RT reaction was a modified T7 primer with 24 thymidines at the 5′ end. The sequence was 5’GGCCAGT GAATTGTAATACGACTCACTATAGGGAGGCGG-(dT) 24-3′. After this, labeled cRNA was synthesized according to the manufacturer’s instructions from the eDNA using the Enzo (New York, NY) RNA Transcript Labeling Kit (cat. no. 900182). Approximately 20 [micro]g cRNA was then fragmented in a solution of 40 mmol/l Tris-acetate, pH 8.1. 100 mmol/l KOAc, and 30 mmol/l MgOAc at 94[degrees]C for 35 min. Labeled cRNA w~m hybridized to the Affymetrix GeneChip Test2 Array to verify the quality of labeled cRNA. After thin, cRNA was hybridized to the Affymetrix MU11K A ,’rod B chip. The cRNA was hybridized overnight at 45[degrees]C. The data were analyzed truing Affymetrix GeneChip version 3.2 software and Spotfire.Net version 5.0 The results are an average of the two experiments.

For microarray experiments on eDNA-based chips (Incyte Genomics, Palo Alto, CA), total RNA was isolated and amplified as described. In vitro transcription was performed using a MEGAscript T7 Kit (And)ion. Austin, TX) according to the manufacturer’s protocol. Amplified ant[sense RNA was purified with an RNeasy mini-kit and protocol (Qiagen, Valencia. CA) and then eluted in a volume of 60 [micro]l RNase-free water. The aRNA was quantified by fluorescence using Ribogreen dye (Molecular Probes, Eugene, OR), and the integrity of the sample was assessed by separation on an Agilent 2100 Bioanalyzer, a high-resolution electrophoresis system (Agilent Technologies, Palo Alto, CA). RNA was submitted to Incyte Genomics (Palo Alto, CA) for fluorescent labeling and hybridization to the Mouse Gem 2 microarray. After scar[rang and data extraction, the results were exported to the GEMTools database for further gene expression analysis.

Real-time PCR analysis. Real-time PCR was performed using the Taqman EZ RT-PCR Core Reagents kit (Perkin Elmer part no. N808-0236). For the analysis, 100 ng total RNA was used The reactions were dime in triplicate. The probe sequences for FAS mRNA were TGCATGACAGCATCCAAGACA-forward probe; CTCTTCCCATGAGATTGGTACCA reverse probe; and AGCT GAGCAGAAAGTCCAGCTGCTCCT-Taqman probe. The probe sequences for spot14 mRNA were CCCAGTTCCACCTGCACTTCT-forward probe; CTCCTG TGCTTTCCGGGTC-reverse probe; and CAGCCTCCATCACATCCTTACCCA CC-Taqman probe.

Statistical analysis. Statistical evaluation was performed via one-way ANOVA and t tests where appropriate using InStat (GraphPad Software, San Diego, CA). The level of significance was P < 0.05 (two-sided test)

RESULTS

Effect of PTP1B reduction on body weights and epididymal fat pads. The anti-PTP1B 2’MOE-modified phosphorothioate oligonucleotides (ASOs) were characterized and selected for follow-up studies as previously described. Insulin-resistant hyperglycemic obese (ob/ob) mice were treated with 25, 2.5, or 0.25 mg/kg PTP1B ASO two times per week for 6 weeks. Plasma glucose levels were reduced by 25% (192 [+ or -] 21 mg/dl) and 49% (131 [+ or -] 3) with 2.5 and 25 mg/kg PTP1B ASO, respectively (saline control = 255 [+ or -] 17 mg/dl), whereas insulin levels were reduced by 77% (6.7 [+ or -] 1 ng/ml) with the 25-mg/kg PTP1B ASO dose only (saline control = 28.9 [+ or -] 4.2 ng/dl). Overall, there was no significant effect of PTP1B ASO treatment on triglycerides and free fatty acid (FFA) plasma levels. At the completion of the study, epididymal fat pads were obtained, homogenized, and analyzed by immunoblotting. PTP1B protein expression in epididymal fat pads was decreased by 33, 46, and 61% by treatment with 0.25, 2.5, and 25 mg/kg PTP1B ASO, respectively.

No significant difference in body weight was observed between animals treated with saline or those treated with 0.25 or 2.5 mg/kg PTP1B ASO over the duration of the study. However, the 25-mg/kg group gained 15% less weight at 5 weeks of treatment (Fig. 1A) without significant effect in the estimated food intake. Growth rate per week was not different between treatments at lower doses, but a small but significant difference was found with the highest dose of antisense treatment (25 mg/kg) at 5 weeks (Fig. 1B).

[FIGURE 1 OMITTED]

To investigate whether the decrease in body mass in the group of animals treated with the higher concentration of antisense could be the consequence of reduced fat stores, epididymal fat pads were obtained and weighed. Epididymal fat weight was unchanged with the lower dose treatment (0.25 mg/kg), and a minimal effect was detected with 2.5 mg/kg ASO (Fig. 2). In contrast, fat weight was significally reduced by 42% in animals treated with 25 mg/kg ASO (P < 0.05, normalized to brain weight) at 6 weeks of treatment.

[FIGURE 2 OMITTED]

Expression of SREBP1 and downstream target genes are downregulated in fat from PTP1B antisense-treated ob/ob mice. Because PTP1B ASO-treated mice showed a decrease of adiposity, and in order to investigate whether the expression of genes coding proteins involved in lipid metabolism were altered by PTP1B ASO treatment, an integrated gene expression study using fat samples was performed. Total RNA was isolated from epididymal fat from ob/ob mice treated with or without 25 mg/kg PTP1B ASO and analyzed by oligonucleotide or cDNA-based microarray, as described in RESEARCH DESIGN AND METHODS. PTP1B gene expression was reduced 2.7-fold by ASO treatment. PTP1B antisense resulted in a coordinate decrease in the expression of genes involved in fatty acid homeostasis (Table 1). Interestingly, PTP1B ASO treatment decreased expression of the transcription factor SREBP1, which regulates several genes involved in lipogenesis in mature adipocytes (12). We also found downregulation of expression of several SREBP1 target genes involved in fatty acid synthesis, including spot14, ATP citrate-lyase, FAS, and steroylCoa desaturases as well as LPL and peroxisome proliferator-activated receptor (PPAR)[gamma], a member of the nuclear hormone receptor family of ligand-activated transcription factors that plays a pivotal role in fat cell differentiation (Table 1). The changes in gene expression of some of these genes were confirmed by hybridization to the Mouse Gem 2 microarray at Incyte Genomics (Table 1) and using quantitative PCR. Figure 3A showed a dose-dependent reduction in spot14 and FAS gene expression, as determined by microarray, that correlated with a dose-dependent reduction of spot14 and FAS, as measured by qPCR analysis (Fig. 3B). Spotl4 and FAS are critical genes involved in fatty acid synthesis from glucose.

[FIGURE 3 OMITTED]

Consistent with this finding, the triglyceride content of fat from PTP1B antisense-treated mice was significantly decreased, in correlation with the decreased SREBP1 expression in these mice (Fig. 4).

[FIGURE 4 OMITTED]

PTP1B reduction regulates IRS-2 and PI 3-kinase isoforms without modifying insulin sensitivity in fat. Although PTP1B has been implicated as a tissue-specific regulator of insulin sensitivity in knock out animals (9) and in the dephosphorylation of IR and IRS-1 after acute insulin stimulation in vivo (8), it is not clear whether a decrease in PTP1B levels can alter the expression of proteins known to be involved in the insulin signaling pathway in fat. Therefore, the protein expression of IR, IRS-1, IRS-2, and PI 3-kinase isoforms was measured in fat by immunoblotting with specific antibodies. No significant differences in IR or IRS-I expression were detected in fat from obese animals treated with PTP1B ASO (data not shown). In contrast IRS-2 levels were significally increased in a dose-dependent manner in fat from ob/ob animals treated with the PTP1B ASO (Fig. 5). In addition, a change in the expression level of splice variants of p85c[alpha] in fat (Fig. 5) was observed in PTP1B ASO-treated animals. This change was characterized by a reduction in p85a and an upregulation of the p50[alpha] splice variant.

[FIGURE 5 OMITTED]

To investigate whether an increase in IRS-2 expression and/or differential expression of PI 3-kinase regulatory subunits observed in fat from the PTP1B ASO-treated ob/ob mice could increase insulin sensitivity, an intraperitoneal insulin challenge (2 units insulin/kg) was performed in ob/ob mice previously treated for 6 weeks with saline or the PTP1B ASO (25 mg/kg i.p. twice per week). Fat was extracted at 1 min postinsulin challenge, and general tyrosine phosphorylation of proteins and PKB phosphorylation at Ser-473 was measured. Treatment with PTP1B ASO had no effect on tyrosine phosphorylation of the IR (data not shown) or on basal or insulin-induced PKB phosphorylation (Fig. 5), suggesting that changes in the levels of PTP1B, IRS-2, or p85 splice variants might not be implicated in the insulin sensitization of downstream pathways like PKB phosphorylation in adipose tissue.

DISCUSSION

In this study, we have demonstrated that reduction of PTP1B levels induced a decrease in adiposity in association with a decrease in fat triglycerides and a downregulation of the main genes that encode proteins involved in lipogenesis.

Adipose tissue is the primary site of energy storage, building triglycerides in response to nutritional excess and releasing this energy in the form of FFAs and glycerol in times of fasting. The ability to carry out these functions efficiently is dependent on changes in the expression of genes that carry out the lipogenesis and the lipolytic program. Among these are many genes whose products are required for lipogenesis, including FAS, ATP citrate lyase, stearoyl CoA desaturase, and proteins involved in triglyceride biosynthesis (PEPCK and pyruvate carboxylase). SREBP1 belongs to a family of transcription factors involved in trygliceride and fatty acid metabolism (15,17,20), and a number of these genes have been shown to be regulated at the transcriptional level by SREBP1 (12,16). In addition, overexpression of FAS in adipose tissue of obese animals, such as ob/ob and db/db mice and fa/fa rats, which exhibit dramatically high levels of lipogenic activities, involves SREBP1 (13,20-22). Interestingly, PTP1B ASO treatment decreased expression of the transcription factor SREBP1 and several SREBP1 target genes, including spot14, ATP citrate-lyase, and FAS in adipose tissue of ob/ob mice. This effect would be expected to reduce lipogenesis. In addition, SREBP and its expression are at least in part dependent on the expression of PPAR[gamma] (23,24), although it has been reported to be regulated by many other factors. SREBP has also been found to activate PPAR[gamma] through production of an endogenous ligand (25) or through the PPAR[gamma]1 and -3 promoters (24) and to stimulate expression of leptin (16). Interestingly, PTP1B reduction in fat downregulated both SREBP1 and PPAR[gamma] gene expression, resulting in a reduction of lipogenic gene expression that should contribute to adipocyte hypertrophy. This result is in agreement with other studies showing that moderate reduction of PPAR[gamma] activity observed in heterozygous PPAR[gamma]-deficient mice decreases triglyceride content in fat, and direct antagonism of PPAR[gamma] reduces lipogenesis in fat and prevents adipocyte hypertrophy (26). In addition, the reduced rate of weight gain and reduced adiposity observed with PTP1B ASO treatment is consistent with previous reports in knock out mice where whole-body fat content reduction was also observed (8,9), and a reduction in obesity might lead to improved insulin action. Similar results have been obtained in normal mice on a high-fat diet treated with the PTP1B ASO (M.B. and B.P.M., unpublished observations). Furthermore, results of magnetic resonance image analysis have demonstrated that abdominal fat and subcutaneous fat storage were reduced by 27 and 16%, respectively, with PTP1B ASO treatment in Zucker fatty rats (27).

Obesity generally involves an increase in both cell size and cell number of adipocytes. SREBP1 may represent a mechanism unifying both (16). It can increase the percentage of cells that differentiate into adipocytes (17) by increasing the transcriptional activity of PPAR[gamma]. Hence, chronic overfeeding and its attending elevation of insulin would be expected to result in increased expression and activity of SREBP1. This is likely to affect not only lipid accumulation in fat cells through increased expression of FAS, LPL, and other lipogenic genes but also increased differentiation of adipocytes from precursor cells (16). In the current study, we have shown that treatment with PTP1B antisense reduces the expression of these lipogenic genes and at the same time reduces adipose tissue mass. Although SREBP1 gene expression is upregulated by insulin and glucose in vitro (16,28), the in vivo significance of these factors in SREBP1 regulation is a matter of controversy. It is likely, however, that in the intact animal, hyperinsulinemia and altered nutritional conditions characteristic of the obese state might induce SREBP1, additionally contributing to altered adipocyte metabolism so that a decrease in plasma insulin levels might lead to a reduction in SREBP1 expression. Yet, PPAR[gamma] activators induce an increase in the expression of lipogenic genes and fat mass, while simultaneously acting as insulin sensitizers, decreasing insulin and glucose levels in the animals (29). This is supported by clinical data showing that patients who take synthetic PPAR[gamma] activators frequently gain weight (30). Furthermore, heterozygous PPAR[gamma] mutant mice exhibit smaller fat stores on a high-fat diet (23,31).

Our results are similar to a study of leptin treatment in which a reduction was observed in the expression of genes encoding lipogenic genes such as SREBP1, spot14, and FAS (32). Thus, mRNA levels of genes involved in fatty acid and cholesterol synthesis are rapidly repressed by leptin administration, in association with an acute decrease in plasma insulin levels and decreased SREBP1 expression (33).

One interesting observation reported in this study was the increase in IRS-2 levels and the differential regulation of p85[alpha] splice variants observed in fat from animals treated with PTP1B ASO, whereas no increases in PKB activation in response to insulin were observed. However, improved insulin-stimulated PKB activation in liver obtained from the same animals was detected (data not shown), suggesting that the increase in insulin sensitivity by PTP1B ASO treatment is tissue specific. These results are in agreement with previous studies using PTP1B KO animals in which no effect on glucose transport in fat was found (9) and with other reports showing that overexpression of PTP1B in adipocytes inhibited insulin-stimulated phosphoinositide 3-kinase activity without altering glucose transport or PKB activation (34). However, we cannot discard the possibility that changes in these proteins might affect other important functions in fat other than glucose transport, such as lipolysis or lipogenesis or regulation of genes involved in these functions. It is known that the lack of IRS-2 has little effect on insulin-stimulated glucose uptake in isolated adipocytes of IRS2-/- mice, so IRS-2 probably does not have an essential role in the insulin pathway resulting in glucose transport in adipose tissue (35). Interestingly, a recent study showed that induction of SREBP1 gene expression was found in liver of diabetic insulin-resistant IRS-2-/- mice (35). This observation raises the possibility that IRS-2 expression could be linked to SREBP1 expression. However, it was not clear in that study whether IRS-2 had a direct role in the regulation of lipogenesis.

In summary, our results demonstrate that PTP1B reduction decreased fat depots and triglyceride levels in fat by downregulating important genes known to be involved in lipogenesis. Our observation provides the first evidence of a PTP1B effect in adipose tissue, with a possible implication of PTP1B in the enlargement of adipocyte energy stores and obesity.

TABLE 1

Differentially expressed genes in fat from ob/ob mice treated with

25 mg/kg PTP1B antisense oligonucleotide

Gene lipid metabolism Affimetrix Incyte

Steroyl CoA desaturase (scd1) -1.7 -8.65

Steroyl CoA desaturase (scd2) -3.4 -2.5

Glutathione-S transferase -3.2 -3.6

FAS -2.5 -3.9

Glycerol 3-P acyltransferase -2.1 -2.1

LPL -2.3 ND

ATP citrate-lyase -1.8 ND

Pyruvate decarboxylase -2.1 -3.1

Spot14 -8.2 -6.6

hormone-sensitive lipase -2.2 -3.65

Transcription factors

ADD1/SREBP -2.7 ND

Adipocyte-specific genes

PPAR[gamma] -2.5 -2.1

The fold changes were determined by microarray hybridization pools

(n=3) from four mice. ND, nondetectable or low signal-to-noise

ratio.

REFERENCES

(1). Kenner KA, Anyanwu E, Olefsky JM, Kusari J: Protein-tyrosine phosphatase 1B is a negative regulator of insulin- and insulin-like growth factor-I-stimulated signaling. J Biol Chem 271:19810-19816, 1996

(2.) Seely BL, Staubs PA, Reichart DR, Berhaum P, Milarski KL, Saltiel AR, Kusari J, Olefsky JM: Protein tyros|he phosphatase 1B interacts with the activated insulin receptor. Diabetes 45:1379 1385, 1996

(3.) Calera MR, Vallega G, Pilch PF: Dynamics of protein-tyrosine phosphatases in rat adipocytes. J Biol Chem 275:6308-6312, 2000

(4.) Salmeen A, Andersen JN, Myers MP, Tonks NK, Barford D: Molecular basis for the dephospborylation of the activation segment of the insulin receptor by protein tyrosine phosphatase 1B. Mol Cell 6:1401-1412, 2000

(5.) Goldstein BJ, Bittner-Kowalczyk A, White MF, Harbeck M: Tyrosine dephosphorylation and deactivation of insulin receptor substrate-1 by protein4yrosine phosphatase 1B: possible facilitation by the formation of a ternary complex with the Grb2 adaptor protein. J Biol Chem 275:4283-4289, 2000

(6.) McGuire MC, Fields RM, Nyomba BL, Raz I, Bogardus C, Tonks NK, Sommercorn J: Abnormal regulation of protein tyrosine phosphatase activities in skeletal muscle of insulin-resistant humans. Diabetes 40:939-942, 1991

(7.) Ahmad F, Goldstein BJ: Increased abundance of specific skeletal muscle protein-tyrosine phosphatases in a genetic model of insulin-resistant obesity and diabetes mellitus. Metabolism 44:1175-1184, 1995

(8.) Elchebly M, Payette P, Michaliszyn E, Cromlish W, Collins S, Loy AL, Normandin D, Cheng A, Himms-Hagen J, Chan CC, Ramachandran C, Gresser MJ, Tremblay ML, Kennedy BP: Increased insulin sensitivity and obesity resistance in mice lacking the protein tyrosine phosphatase-1B gene. Science 283:1544-1548, 1999

(9.) Klaman LD, Boss O, Peroni OD, Kim JK, Martino JL, Zabolotny JM, Moghal N, Lubkin M, Kim YB, Sharpe AH, Stricker-Krongrad A, Shulman GI, Neel BG, Kahn BB: Increased energy expenditure decreased adiposity, and tissue-specific insulin sensitivity in protein-tyrosine phosphatase 1B-deficient mice. Mol Cell Biol 20:5479-5489, 2000

(10.) Zinker B, Clampit J, Nguyen H, Wilcox D, Jacobson P, Crosby S, Rondinone CM, Butler M, Murray S. McKay R, Bhanot S, Monia B, Reilly R, Opgenorth T, Trevillyan J, Jirousek JR: Anti-diabetic effects of protein tyrosine phosphatase 1B (PTP1B) antisense treatment in a rodent model of diabetes (Abstract). Diabetes 50 (Suppl. 2):A332, 2001

(11.) Bray GA, York DA: The MONA LISA hypothesis in the time of leptin. Recent Prog Horm Res 53: 95-117, 1998

(12.) Osborne TF: Sterol regulatory element-binding proteins (SREBPs): key regulators of nutritional homeostasis and insulin action. J Biol Chem 275:32379-32382, 2000

(13.) Boizard M, Le Liepvre X, Lemarchand P, Foufelle F, Ferre P, Dugail I: Obesity-related overexpression of fatty-acid synthase gene in adipose tissue involves sterol regulatory element-binding protein transcription factors. J Biol Chem 273:29164-29171, 1998

(14.) Lopez JM, Bennett MK, Sanchez HB, Rosenfeld JM, Osborne TF: Sterol regulation of acetyl coenzyme A curboxylase: a mechanism for coordinate control of cellular lipid. Proc Natl Acad Sci U S A 93:1049-1053, 1996

(15.) Ericsson J, Jackson SM, Kim JB, Spiegelman BM, Edwards PA: Identification of glycerol-3-phosphate acyltransferase as an adipocyte determination and differentiation factor 1- and sterol regulatory element-binding protein-responsive gene. J Biol Chem 272:7298-7305, 1997

(16.) Kim JB, Sarraf P, Wright M, Yao KM, Mueller E, Solanes G, Lowell BB, Spiegelman BM: Nutritional and insulin regulation of fatty acid synthetase and leptin gene expression through ADD1/SREBP1. J Clin Invest 101:1-9, 1998

(17.) Kim JB, Spiegelman BM: ADD1/SREBP1 promotes adipocyte differentiation and gene expression linked to fatty acid metabolism. Genes Dev 10:1096-1107, 1996

(18.) Dean NM, Buffer M, Monia BP, Manoharan M: Pharmacology of 2′-0-(2-methoxy) ethyl modified antisense oligonucleotides. In Antisense Drug Technology: Principles, Strategies and Applications. Crooke ST, Ed. New York, Marcel Dekker, 2001, p. 319-338

(19.) Rondinone CM, Rodbard D, Baker ME: Aldosterone stimulates differentiation of mouse 3T3-L1 cells into adipocytes. Endocrinology 132:2421-2426, 1993

(20.) Shimano H, Horton JD, Hammer RE, Shimomura I, Brown MS, Goldstein JL: Overproduction of cholesterol and fatty acids causes massive liver enlargement in transgenic mice expressing truncated SREBP-1a. J Clin Invest 98:1575-1584, 1996

(21.) Shimomura I, Shimano H, Horton JD, Goldstein JL, Brown MS: Differential expression of exons 1a and 1c in mRNAs for sterol regulatory element binding protein-1 in human and mouse organs and cultured cells. J Clin Invest 99:838-845, 1997

(22.) Bennett MK, Lopez JM, Sanchez HB, Osborne TF: Sterol regulation of fatty acid synthase promoter: coordinate feedback regulation of two major lipid pathways. J Biol Chem 270:25578-25583, 1995

(23.) Kubota N, Terauchi Y, Mild H, Tamemoto H, Yamauchi T, Komeda K, Satoh S, Nakano R, Ishii C, Sugiyama T, Eto K, Tsubamoto Y, Okuno A, Murakami K, Sekihara H, Hasegawa G, Naito M, Toyoshima Y, Tanaka S, Shiota K, Kitamura T, Fujita T, Ezaki O, Aizawa S, Nagai R, Tobe K, Kimura S, Kadowaki T: PPAR gamma mediates high-fat diet-induced adipocyte hypertrophy and insulin resistance. Mol Cell 4:597-609, 1999

(24.) Fajas L, Schoonjans K, Gelman L, Kim JB, Najib J, Martin G, Fruchart JC, Briggs M, Spiegelman BM, Auwerx J: Regulation of peroxisome proliferator-activated receptor gamma expression by adipocyte differentiation and determination factor 1/sterol regulatory element binding protein 1: implications for adipocyte differentiation and metabolism. Mol Cell Biol 19: 5495-503, 1999

(25.) Kim JB, Wright HM, Wright M, Spiegelman BM: ADD1/SREBP1 activates PPARgamma through the production of endogenous ligand. Proc Natl Acad Sci U S A 95:4333-4337, 1998

(26.) Yamauchi T, Kamon J, Waki H, Murakami K, Motojima K, Komeda K, Ide T, Kubota N, Terauchi Y, Tobe K, Mild H, Tsuchida A, Akanuma Y, Nagai R, Kimura S, Kadowaki T: The mechanisms by which both heterozygous peroxisome proliferator-activated receptor gamma (PPARgamma) deficiency and PPARgamma agonist improve insulin resistance. J Biol Chem 276:41245-54, 2001

(27.) Nuss M, Hradil V, Shapiro R, Airier A, Mika A, Clampit J, Bush E, Xie N, Jacobson P, Jirousek M, Zinker B: Effects of protein phosphatase 1B (PTP1B) antisense oligonucleotide (ASO) treatment on fat volume using MRI in Zucker fatty rats (Abstract). Diabetes 50:A377, 2001

(28.) Hasty AH, Shimano H, Yahagi N, Amemiya-Kudo M, Perrey S, Yoshikawa T, Osuga J, Okazaki H, Tamura Y, Iizuka Y, Shionoiri F, Ohashi K, Harada K, Gotoda T, Nagai R, Ishibashi S, Yamada N: Sterol regulatory element-binding protein-1 is regulated by glucose at the transcriptional level. J Biol Chem 275:31069-31077, 2000

(29.) Way JM, Harrington WW, Brown KK, Gottschalk WK, Sundseth SS, Mansfield TA, Ramachandran RK, Willson TM, Kliewer SA: Comprehensive messenger ribonucleic acid profiling reveals that peroxisome proliferator-activated receptor gamma activation has coordinate effects on gene expression in multiple insulin-sensitive tissues. Endocrinology 142:1269-1277, 2001

(30.) Fuchtenbusch M, Standl E, Schatz H: Clinical efficacy of new thiazolidinediones and glinides in the treatment of type 2 diabetes mellitus. Exp Clin Endocrinol Diabetes 108:151-168, 2000

(31.) Miles PD, Barak Y, He W, Evans RM, Olefsky JM: Improved insulin-sensitivity in mice heterozygous for PPAR-gamma deficiency. J Clin Invest 105:287-292, 2000

(32.) Soukas A, Cohen P, Socci ND, Friedman JM: Leptin-specific patterns of gene expression in white adipose tissue. Genes Dev 14:963-980, 2000

(33.) Liang CP, Tall AR: Transcriptional profiling reveals global defects in energy metabolism, lipoprotein and bile acid synthesis and transport with reversal by leptin treatment in ob/ob mouse liver. J Blot Chem 276:49066-49076, 2001

(34.) Venable CL, Frevert EU, Kim YB, Fischer BM, Kamatkar S, Neel BG, Kahn BB: Overexpression of protein-tyrosine phosphatsse-1B in adipocytes inhibits insulin-stimulated phosphoinositide 3-kinase activity without altering glucose transport or AM/Protein kinase B activation. J Biol Chem 275:18318-18326, 2000

(35.) Tobe K, Suzuki R, Aoyama M, Yamauchi T, Kamon J, Kubota N, Terauchi Y, Matsui J, Akanuma Y, Kimura S, Tanaka J, Abe M, Ohsumi J, Nagai R, Kadowaki T: Increased expression of the sterol regulatory element-binding protein-1 gene in IRS-2 (-/-) mouse liver. J Biol Chem 276:38337-38340, 2001

Cristina M. Rondinone, (1) James M. Trevillyan, (1) Jill Clampit, (1) Rebecca J. Gum, (1) Cathy Berg, (1) Paul Kroeger, (1) Leigh Frost, (1) Bradley A. Zinker, (1) Regina Reilly, (1) Roger Ulrich, (1) Madeline Butler, (2) Brett P. Monia, (2) Michael R. Jirousek, (1) and Jeffrey F. Waring (1)

From (1) Metabolic Diseases Research, Global Pharmaceutical Research and Development, Abbott Laboratories, Abbott Park, Illinois; and (2) Isis Pharmaceuticals, Carlsbad, California.

Address correspondence and reprint requests to Cristina M. Rondinone, Abbott Laboratories, Metabolic Diseases Research, Department 47R, Building AP10, 100 Abbott Park Rd., Abbott Park, IL 60064. E-mail: cristina.rondinone @abbott.com.

Received for publication 13 March 2002 and accepted in revised form 17 May 2002.

R.U. is employed by Rosetta Inpharmatics and holds stock in Abbott Laboratories and Pharmacia.

2’MOE, 2′-0-(2-methoxy)-ethyl; ASO, antisense oligonucleotide; FAS, fatty acid synthase; FFA, free fatty acid; IR, insulin receptor; IRS, insulin receptor substrate; LPL, lipoprotein lipase; PI, phosphatidylinositol; PKB, protein kinase B; PPAR, peroxisome proliferator-activated receptor; PTP1B, protein tyrosine phosphatase 1B; SREBP, sterol regulatory element-binding protein.

COPYRIGHT 2002 American Diabetes Association

COPYRIGHT 2002 Gale Group