An upstream element from the human insulin receptor gene promoter contains binding sites for C/EBP-beta and NF-1 – protein C/enhancer binding protein-beta

An upstream element from the human insulin receptor gene promoter contains binding sites for C/EBP-beta and NF-1 – protein C/enhancer binding protein-beta – nuclear factor

Nicholas J.G. Webster

We have shown previously that a 500-bp region of the human insulin receptor promoter (-0.3 to -1.8 kb) was able to stimulate transcription from a heterologous thymidine kinase promoter in HepG2 hepatoma cells but not in HeLa fibroblasts. Footprint analysis localized the transcription factor binding sites to a 36-bp region at -1420. In this paper, we analyze the factors that recognize this element and show that it contains binding sites for the CAAT/enhancer binding protein C/EBP and nuclear factor 1 (NF-1). In addition we show that both C/EBP[alpha] and the C/EBP[beta] can transactivate the human insulin receptor promoter in a dose-dependent manner. Diabetes 43:305-12, 1994

The insulin receptor (IR) mediates all of insulin’s known effects on cellular metabolism and is expressed ubiquitously. The classic insulin target tissues, however, contain higher levels of insulin receptor (IR) protein leading to increased insulin sensitivity. The level of the protein correlates with the level of the mRNA, which, in turn, is determined by the rates of transcription of the gene, processing of the primary transcript, and degradation of the mature mRNA. The expression of the IR gene has been shown to be regulated at both the transcriptional and posttranscriptional level. Although the gene is not regulated acutely, IR mRNA levels have been shown to respond to numerous hormonal, metabolic, and developmental stimuli. Dexamethasone, progesterone, androgens, and glucose all increase mRNA levels; it has been shown by nuclear run-off assays that dexamethasone increases transcription of the gene [1-5]. Chronic insulin exposure reduces mRNA levels and consequently streptozocin-induced diabetes causes an increase in hepatic and renal IR mRNA [6-9]. The gene is induced on differentiation of 3T3-L1 adipocytes, BC3H1 myocytes, and RAJI lymphoma cells and is developmentally regulated in the rat [1,10-13]. Aging reduces hepatic IR mRNA levels in the mouse [14]. The stability of the mRNA is affected by both cell type and growth status and, finally, the alternative splicing of the pre-mRNA shows both hormonal and developmental regulation [13,15-17].

The posttranscriptional effects alone are not sufficient to explain the differences in expression observed in different tissues. Hence a number of groups have analyzed the 5′ flanking region of the IR gene [18-25]. Using transient transfection of promoter deletions into cells in culture, the majority of promoter activity has been localized to a GC-rich region containing multiple Sp 1 binding sites [21,24-27]. McKeon and Pham have shown that the CAAT/enhancer binding protein C/EBP[alpha] can stimulate the promoter in NIH3T3 cells and have evidence for other adipocyte specific factors in 3T3-L1 cells (28 and McKeon, unpublished observations). We have published results previously that suggested that there may be elements further upstream in the 5′ flanking region that confer cell specificity [29]. In this paper, we describe one of these elements and the factors that regulate its activity. We show that the element contains binding sites for C/EBP[beta] and nuclear factor 1 (NF-1) and that C/EBP[beta] can transactive the human IR (hIR) promoter.

RESEARCH DESIGN AND METHODS

Construction of plasmids. All plasmid constructions were performed using standard techniques. The construction of pIRC1, pIRC.BP, and pBLCAT[delta]tk has been described previously [29]. Artificial promoters containing multimers of the US1 site were constructed by ligating double-stranded oligonucleotides (sense oligonucleotide: 5’ACCCATTACACAAGTGAAACTGGCCCAGAGA CAGAAAAGTC3′; antisense oligonucleotide: 5’GACTTT TCTGTCTCTGGGCCAGTTTCACTTGTGTAATGGGT3′) into the blunt-ended BamH1 site of pBLCAT[8.sup.+], which contains the chloramphenicol acetyltransferase (CAT) gene under the control of a deleted herpes simplex virus thymidine kinase (tk) promoter (- 105 to 51). The number and orientation of inserts were determined by dideoxy sequencing. Labeled oligonucleotide probes were generated by 5′ end-labeling the US1 oligos with [gamma]-[sup.32P]]ATP and T4 polynucleotide kinase before annealing.

Cotransfections and CAT assays. HepG2 cells were maintained in minimum essential medium plus Earle’s salts with 10% fetal calf serum (MEM-Earle’s). Cells were transfected at 30-50% confluence in 6-cm dishes with a total of 6 [micro]g of plasmid DNA using the calcium phosphate coprecipitation techniques. In all cases, the reference plasmid RSV-lacZ, which contains the [beta]-galactosidase gene under the control of the Rous sarcoma virus long terminal repeat, was cotransfected to correct for transfection efficiency. The precipitate was removed after 8 h, then the cells were subjected to a glycerol shock (10% glycerol in MEM-Earle’s) for 3 min at 37 [degrees] C before being refed with medium. Cells were harvested 48 h after transfection, lysed in 250 [micro]l of modified lysis buffer by three cycles of freeze-thaw, centrifuged at 10,000 g for 15 minutes at 4 [degrees] C, and the supernatant stored at -80 [degrees] C [30]. The [beta]-galactosidase activity in the extract was measured in a 96-well format using a modification of the method of Herbomel et al. [31]. Namely, 25 [micro]l of extract was diluted to 100 [micro]l with lac-Z buffer [31]. The reaction was initiated by the addition of 150 [micro]l of a 4 mg/ml solution of o-nitrophenyl-galactopyranoside in lac-Z buffer. The increase at 405 nm was measured on a THERMOmax microplate reader and compared with a standard curve generated from serial dilutions of [beta]-galactosidase using the SOFTmax kinetic analysis software (Molecular Devices, Menlo Park, CA). CAT activity was measured using the procedure of Sleigh [32]. Extracts were heated at 65 [degrees] C for 30 min in the presence of 5 mM EDTA before the assay [33]. CAT protein levels were measured using an ELISA kit (5′-3′, Boulder, CO).

Nuclear extracts and gel-shift assays. Rat liver nuclear extracts were prepared by the method of Graves et al. [34]. For the gel-shift assays, 1-5 [micro]g of nuclear extract was preincubated with 10 [micro]g poly-d(I.C) in 20 [micro]l TGMEDK buffer (25 mM Tris-HCI, pH 7.9, 10% glycerol, 5 mM [MgCl.sub.2], o.1 mM EDTA, 1 mM dithiothreitol, 100 mM KCI) for 15 min at 0 [degree] C. The [sup.32]P-labeled US1 probe (20,000 cpm) was added, and the incubation continued for a further 60 min at 0 [degree] C. Free and bound probe were separated on a nondenaturing 5% polyacrylamide gel at 10-15 mA using a Tris-glycine buffer [35]. Gels were dried and subjected to autoradiography. In competition experiments, double-stranded oligonucleotides containing transcription factor binding sites from other promoters were included in the incubation. The sequences of these competitors were: US3, a footprint identified previously at -1120 of the hIR promoter: 5’TGCACATTTTTC CAGGTGTCATTTCTCCAACTTGAACACAG3′ [29]; the D30 element of the c-Ki-ras promoter: 5’GCTCCCTCC CTCCCTCCTTCCCTCCCTCCC3′ [36]; the initiator element of the adenovirus major late promoter: 5’GTCC TCACTCTCTTCCG3′ [37]; a TCCC-rich sequence from the hIR promoter (-577) that competes for the D30 factor: 5’CCTCCCTCCCCTGCAAGCTTTCCCTCCCTCTCCTG3′ [36]; the LF-A1 site from the [alpha]-1 anti-trypsin gene: 5’G CCAGTGGACTTAGCCCCTGTTTGG3′ [38]; the D-box from the rat albumin promoter: 5’TGGTATGATTTTGT AATGGGGTAG3′ [39]; and US1m5 containing point mutations at 5 key G residues in US1: 5’ACCCATTACAC AAGTGAAACTTTACCAGATAAAGAAAAGTCCC3′ Methylation interference assays were performed using standard protocols [35].

RESULTS

Transfection of US1 reporter genes into HepG2 cells. Previously, we had shown that a 500-bp region of the IR promoter between -1.3 and -1.8 kb can activate transcription from a minimal tk promoter in HepG2 hepatoma cells but not in HeLa fibroblasts. Furthermore, we were able to demonstrate specific binding to a 36-bp sequence centered at -1420 using a rat liver nuclear extract. In this study, we focused on a characterization of this promoter element and the nuclear factors that recognize it. A 42-bp double-stranded oligonucleotide (US1) covering nucleotides -1400 to -1442 of the hIR promoter was synthesized. These oligonucleotides were subcloned upstream of the tk promoter to test their function in vivo. The resulting CAT plasmids were transfected into HepG2 cells and the CAT enzyme activity and protein level were determined (Fig. 1). A single copy of the US1 element (US1#1) was able to stimulate CAT activity 3.6-fold to a level similar to pIRC.BP, which contains the whole 500-bp fragment. This result, together with the fact that we were only able to identify one footprint within this 500-bp region, suggests that US1 is the important functional element within this region. Additional copies of US1 lead to a further enhancement in CAT expression irrespective of their orientation (US1#3,6, and 5). Five copies of US1 gave a 14.2-fold induction. The effect of each element appears to be additive rather than synergistic. This is reminiscent of the GT-1 motif of the SV-40 enhancer (a class B enhanson), which has very weak activity when oligomerized alone but enhances strongly when associated with a second GT-11C motif [40].

Gel-shift analysis of the upstream enhancer US1. Having established that the US1 element is functional in vivo, we used in vitro binding assays to investigate the transcription factors that can recognize this sequence. Gel-shift assays were performed with [sup.32P]-labeled US1 oligonucleotides using a rat liver nuclear extract (Fig. 2). Three retarded complexes, one major and two minor, were observed with increasing concentrations of extract (Fig. 2A), which could be competed by unlabeled US1 (Fig. 2B). We had noted previously that the sequence of US1 revealed an asymmetric distribution of pyrimidines and purines. Therefore, we used competition assays with unlabeled double-stranded oligonucleotides containing binding sites for transciption factors that are known to recognize such sequences (Fig. 2C). US3 is a sequence derived from a footprint that we had identified in a cluster of binding sites at -1120 of the hIR promoter that shows a similar asymmetric distribution. The D30 sequence binds a factor that is essential for the activity of the c-Ki-ras promoter and recognizes direct repeats of the sequence TCCC [36]. The hIR TCCC sequence is derived from the hIR promoter and has been shown to compete for the same c-Ki-ras factor. The initiator element was identified first in the terminal nucleotidyltransferase and Adenovirus major late promoters and is characterized by a pyrimidine-rich sequence [37]. US1 also contains a weak similarity to the LF-A1 site of the [alpha]1 anti-trypsin gene promoter and the D-box of the albumin gene promoter [38,39].

Labeled US1 (50 fmol) was incubated with the rat liver extract in the presence of either 5 or 50 pmol of the unlabeled competitors (Fig. 2C). Unlabeled US1 competed for binding to all three complexes at both concentrations as expected. Unexpectedly, US3 competed for all three complexes at the higher concentration, which suggests that these factors could also bind to the US3 site albeit with a somewhat lower affinity. The D30, the AdML initiator, and the LF-A1 site did not compete at either concentration. The hIR TCCC element and the albumin D-box were able to compete for the uppermost of the three complexes at both 5 and 50 pmol but had no effect on the other two complexes. As the c-Ki-ras D30 did not compete yet the hIR TCCC sequence did, the uppermost complex is unlikely to be related to the factor that recognizes the TCCC repeat that is common to both of these. The major difference between these two sequences is the presence of a HindIII restriction site in the middle of the hIR TCCC element.

The competition by the albumin D-box oligonucleotides suggested that one of the factors that recognizes US1 may be related to the D-box binding factors. Three factors are known to bind to the rat albumin D-box: the D-box binding protein DBP and the CAAT/enhancer binding proteins C/EBP[alpha] and C/EBP[beta] [39,41]. Gel-shift analysis using recombinant C/EBP[beta] generated a complex of the same mobility as the uppermost complex with the rat liver extract (Fig. 2D). It is likely that both C/EBP[alpha] and C/EBP[beta] and possibly [alpha]/[beta] dimers are present in the liver extract but we see no evidence for either C/EBP[alpha] or hybrids binding to the US1 element. Both C/EBP[beta] and C/EBP[alpha] can recognize the US1 element as retarded complexes can be obtained when C/EBP[alpha] is overexpressed in HepG2 cells. The C/EBP [alpha] complex, however, has a lower mobility than any of the complexes seen with the rat liver extract. Perhaps the sequence context of the US1 element effects the relative affinities for the two factors. The hIR TCCC sequence was also able to compete for the C/EBP[beta] complex on US1, which suggests that C/EBP[beta] recognizes an element in the proximal promoter in addition. Moreover, C/EBP[beta] can be competed by higher concentrations of US3, which indicates that there may be other lower affinity C/EBP[beta] binding sites within the promoter. Alignment of the D-box, US1, US3, and hIR TCCC oligonucleotides shows sequence similarity to a C/EBP[beta] site (Fig. 3). It is noteworthy that both the TCCC and US3 sequences contain two mismatches with the consensus binding site.

Methylation interference assay. We performed methylation interference assays on US1 oligonucleotides to determine the sequence specificity of the major faster migrating complex. Unfortunately, we were only able to analyze this complex as the slower migrating complexes are much weaker (Fig. 2). Both strands were analyzed. Representative autoradiographs are shown in Fig.4, and the results are summarized in Fig. 5A. Methylation of five G residues, three on the sense strand and two on the antisense, prevented the formation of a retarded complex. These five residues lie between – 1408 and – 1421 in the two arms of an inverted repeat separated by a 5 nucleotide spacer. US1 oligonucleotides containing G[right arrow]T mutations at all of the five essential G residues were synthesized (US1 m5). This mutant binding site was unable to compete for the major and the lower of the two minor complexes in competition gel-shift assays with labeled US1, which suggests that the two complexes are related (Fig. 5B). However, the mutant could still compete for the C/EBP[beta] complex, which indicates that this factor binds to a different sequence. Similar results were obtained with a mutant oligonucleotide containing only two G[right arrow]T mutations (data not shown).

We aligned this sequence to Genbank and identified a site in the human [beta]-actin promoter that is highly conserved (14 of 15 residues), the only difference being a G[right arrow]T change at one of the noncritical residues in the spacer (Fig. 5A). A similar sequence is present in the mouse immunoglobulin G (lgG) [mu] lucus with the only change being a G[right arrow]C change in the spacer region. The [beta]-actin oligo was able to compete for the same two complexes on US1 and was able to stimulate transcription from the tk promoter (data not shown). The US3 oligos were also able to compete for all complexes on US1 albeit with lower affinity (Fig. 2C). Alignment of US1 and US3 shows 53% sequence identity in this region (8 of 15 residues, Fig. 5A). All of the sequences fit the consensus binding site for NF-1 [42]. The two complexes seen on US1 are probably attributable to different members of the NF-1 family rather than multimerization as we cannot chase the lower complex into the upper by increasing the amount of nuclear extract (Fig. 2A).

Transactivation of the hIR promoter by C/EBP[alpha] and C/EBP[beta]. The in vitro studies suggested that C/EBP[beta] is one transcription factor that can recognize the upstream element US1. Accordingly, we determined whether C/EBP[beta] could transactivate the hIR promoter in vivo. The plasmid pIRC1, which contains the hIR promoter (-1.8 to -290 kb) upstream of the CAT gene, was transfected into HepG2 cells with increasing concentrations of an expression vector for C/EBP[beta]. HepG2 cells do not normally express either C/EBP[beta], C/EBP[alpha], or DBP, which are expressed in adult hepatocytes (M. Chojkier, unpublished observations). C/EBP[beta] caused a dose-dependent increase in CAT gene expression as measured by both enzyme activity and protein level (Fig. 6A). Cotransfection with an expression vector for C/EBP[alpha] caused a similar induction but only to | 50% of the level of C/EBP[beta]. An expression vector for DBP was without effect as the sequence identity with the albumin D-box is within the C/EBP site and does not extend to the DBP binding site (Fig. 6A). The promoterless CAT vector pBLCAT[delta]tk was not induced significantly by C/EBP[beta] but the tk promoter in pBLCAT8+ was induced very strongly (Fig. 6B). This promoter contains a consensus CAAT-box to which C/EBP[beta and C/EBP[alpha] are known to bind with high affinity. Consequently, it was not possible to test the inducibility of the US1 reporter genes described in Fig. 1 because of the presence of the tk promoter.

DISCUSSION

How do these results fit into the overall picture of the regulation of the IR gene? The factors known to bind to the gene promoter are summarized in Fig. 7. Many groups have documented the importance of multiple Sp 1 binding sites clustered in two regions within the proximal promoter [21, 24-27]. Elimination of either cluster impairs transcriptional activation but the upstream cluster at -600 is quantitatively more important [26]. As we have discussed before, these sites are unlikely to be the major determinant of the tissue-specific expression of the IR gene as the distribution of Sp 1 does not mirror that of the IR. In particular, the levels of Sp 1 in liver, fat, and muscle in the adult mouse are very low [43]. This does not mean that the Sp 1 sites are not important in these tissues. Indeed, treatment of primary hepatocytes with mithramycin A, which binds to GC-rich sequences and blocks the binding of Sp1, severely decreases IR mRNA levels (N.J.G.W., Y.K., K.E.C., J.L.R., unpublished observations). Perhaps other factors bind to these GC-rich sites, or cooperative binding to multiple sites allows transcriptional initiation even in the presence of low levels of Sp 1. Levy and Hug [27] have evidence in support of the former possibility. Lee et al. [25] have identified two factors, IRNF-1 and IRNF-2, that recognize sequences around -540 and -510, respectively, which lie between the clusters of Sp 1 sites and correspond to a weak transcriptional enhancer that was observed by Mckeon et al.[21]. These sequences are conserved in the mouse promoter [23]. In addition, it has been shown that the glucocorticoid receptor can bind to two GREs in the promoter [44]. The regulation in muscle is not known, but Brunetti and Goldfine [45] have evidence for a factor that binds to an AT-rich sequence at – 1.7 kb that is induced on differentiation of the musclelike BC3H1 cell and the 3T3-L1 adipocyte [45]. A number of other potential footprints have been observed but the factors that recognize the sequences have yet to be determined [27,29].

The tissue specificity in liver and fat most likely originates from multiple binding sites for members of the C/EBP family. McKeon and Pham [28] showed that C/EBP[alpha] could transactivate the promoter in NIH-3T3 cells and in this paper we show that both C/EBP[beta] and C/EBP[alpha] can transactivate in HepG2 cells. Based on sequence comparisons, McKeon and Pham [28] indentified two potential C/EBP[alpha] sites in the IR promoter, one at – 1434 and the other at – 1305. In addition, they found evidence for a C/EBP[alpha] site within the first intron of the gene, which may respond to C/EBP[alpha] more strongly than those in the promoter [28]. We show here that C/EBP[beta] can bind to the site at – 1434, which lies within the US1 element. In our original footprint analysis we did not observe protection over the second potential site at – 1305. This was attributable to the use of a Pst1 restriction enzyme site to generate labeled probes, which is coincident with this second C/EBP[alpha] sequence. The high sequence identity between these two sites suggests that C/EBP[beta] would also bind to the site at – 1305. C/EBP[beta] may also recognize other sites in the promoter as oligos from two other regions, -577 and -1.1 kb, were able to compete in gel-shift assays. In vivo, we showed that both C/EBP[beta] and C/EBP[alpha] but not DBP could transactivate the hlR promoter in a dose-dependent manner. Truncation of the hlR promoter at – 1.3 kb that eliminates the US1 element only causes a 30% reduction in the stimulation by C/EBP[beta], which suggests that some of the other potential binding sites may be functional in vivo (data not shown).

C/EBP[beta] has been cloned also as the interleukin-6 nuclear factor (NF-IL6 in humans or IL-6DBP in rats) that regulates the expression of the IL-6 gene, various genes involved in the acute-phase response, and other cytokine genes such as tumor necrosis factor, interleukin-8, and granulocyte colony-stimulating factor [46,47]. We found that the hlR promoter (pIRC1) was induced approximately twofold by a 16-h treatment with 10 ng/ml of recombinant IL-6 and required cotransfection of an expression vector encoding C/EBP[beta] (data not shown). This is interesting for two reasons; it confirms that HepG2 cells do not contain endogenous C/EBP[beta] and, moreover, it suggests a possible role for cytokines such as IL-6 in the regulation of the IR gene.

It is interesting that we identified NF-1 binding sites in close proximity to the C/EBP[beta] sites at – 1434 and – 1305. Binding sites for NF-1 have been identified in tissue-specific enhancers in many genes [48]. Furthermore, an NF-1 protein that recognizes the TGGCA motif in the human albumin and retinol-binding protein genes has been cloned from rat liver [49]. At least six proteins of molecular weight 52-66 kDa make up the NF-1 family and the relative proportions of each can vary with the growth state of the cells [50,51]. Graves et al. [52] have recently identified an NF-1-like factor that is important for the activity of the adipocyte enhancer of the aP2 gene. The NF-1 site is not sufficient for adipocyte expression but rather potentiates the activity of other adipocyte-specific factors. This is consistent with the ubiquitous expression of many members of the NF-1 family. NF-1 has been classed as a type B enhancer in that multimers of this binding site alone are not active as enhancers but can stimulate transcription when associated with a second binding site [47]. The presence of an NF-1 site in close proximity to a C/EBP[beta] site suggests that a similar situation exists in the hIR promoter; the tissue specifically is provided by the C/EBP[beta] site and its activity potentiated by the NF-1 site. The additive stimulation of the tk promoter by a pentamer of the US1 sequence (Fig. 1B) is the sole result of multimerization of the NF-1 motif as HepG2 cells do not express C/EBP[beta]. Cotransfection of an expression vector for C/EBP[beta] does cause a large increase in CAT expression (data not shown) but this is obscured by the fact that the tk promoter itself is induced very strongly by C/EBP[beta] (Fig. 6B).

In summary, we have analyzed the factors that recognize an upstream element in the hlR promoter. This element US1 contains a binding site for C/EBP[beta] and an adjacent site for NF-1. We have demonstrated further that both C/EBP[beta] and C/EBP[alpha] can transactivate the hlR promoter in HepG2 cells.

REFERENCES

[1.] Mamula PW, McDonald AR, Brunetti A, Okabayashi Y, Wong KY, Maddux BA, Logsdon C, Goldfine ID: Regulating insulin receptor gene expression by differentiation and hormones. Diabetes Care 13:288-301, 1990

[2.] Rouiller DG, McKeon C, Taylor Sl, Gorden P: Hormonal regulation of insulin receptor gene expression. J Biol Chem 263:13185-90, 1988

[3.] Papa V, Reese CC, Brunetti A, Vigneri R, Siiteri PK, Goldfine ID: Progestins increase insulin receptor content and insulin stimulation of growth in human breast carcinoma cells. Cancer Research 50:7858-62, 1990

[4.] Sesti G, Marini MA, Briata P, Tullio AN, Montemurro A, Borboni P, De Pirro P, Gherzi R, De Lauro R: Androgens increase insulin receptor mRNA levels, insulin binding and insulin responsiveness in hep-2 larynx carcinoma cells. Mol Cell Endocrinol 86:111-18, 1992

[5.] Briata P, Briata L, Gherzi R: Glucose starvation and glycosylation inhibitors reduce insulin receptor gene expression: characterization and potential mechanism in human cells. Biochem Biophys Res Commun 169:397-405, 1990

[6.] Rohilla AMK, Anderson C, Wood WM, Berhanu P: Insulin downregulates the steady-state level of its receptor’s messenger ribonucleic acid. Biochem Biophys Res Commun 175:520-26, 1991

[7.] Okabayashi Y, Maddux BA, McDonald AR, Logsdon C, Williams JA, Goldfine ID: Mechanisms of insulin induced insulin receptor down-regulation. Diabetes 38:182-87, 1989

[8.] Sechi LA, Griffin CA, Grady EF, Grunfeld G, Kalinyak JE, Schambelam M: Tissue specific regulation of insulin receptor mRNA levels in rats with STZ-induced diabetes mellitus. Diabetes 41:1113-18, 1992

[9.] Tozzo E, Desbuquois B: Effects of STZ-induced diabetes and fasting on insulin receptor mRNA expression and insulin receptor gene transcription in rat liver. Diabetes 41:1609-16, 1992

[10.] Brunetti A, Goldfine ID: Differential effects of fibroblast growth factor on insulin receptor and muscle specific protein gene expression in BC3H1 myocytes. Mol Endocrinol 4:880-85, 1990

[11.] Newman JD, Eckardt GS, Boyd A, Harrison LC: Induction of the insulin receptor and other differenttiation markers by sodium butyrate in the Burkitt lymphoma cell, Raji. Biochem Biophys Res Commun 161:101-106, 1989

[12.] Bassas L, Lesniak MA, Serrano J, Roth J, De Pablo F: Developmental regulation of insulin and type I insulin and type I insulin-like growth factor receptors and absence of type II receptors in chicken embryo tissues. Diabetes 37:637-44, 1988

[13.] Giddings SJ, Carnaghi LR: Insulin receptor gene expression during development: developmental regulation of insulin receptor mRNA abundance in emrbryonic rat liver and yolk sac, developmental regulation of insulin receptor gene splicing, and comparison to abundance of insulin-like growth factor I receptor mRNA. Mol Endocrinol 6:1665-72, 1992

[14.] Mote PL, Grizzle JM, Walford RL, Spindler SR: Aging alters hepatic expression of insulin receptor and c-jun mRNA in the mouse. Mutation Research 256:7-12, 1991

[15.] Tewari M, Tewari DS, Taub R: Posttranscriptional mechanisms account for differences in steady state levels of insulin receptor messenger RNA in different cells. Mol Endocrinol 5:653-60, 1991

[16.] Levy JR, Hug V: Regulation of insulin receptor gene expression. J Biol Chem 267:25289-95, 1992

[17.] Kosaki A, Webster NJG: Effect of dexamethasone on the alternative splicing of the insulin receptor mRNA and insulin action in HepG2 hepatoma cells. J Biol Chem 268:21991-96, 1993

[18.] Mamula PW, Wong KY, Maddux BA, McDonald AR, Goldfine ID: Sequence and analysis of promoter region of human insulin receptor gene. Diabetes 37:1241-46, 1988

[19.] Araki E, Shimada F, Uzawa H, Mori M, Ebina Y: Characterization of the promoter region of the human insulin receptor gene. J Biol Chem 262:16186-91, 1987

[20.] Seino S, Seino M, Nishi S, Bell GI: Structure of the human insulin receptor gene and characterization of its promoter. Proc Natl Acad Sci USA 86:114-18, 1989

[21.] McKeon C, Moncada V, Pham T, Salvatore P, Kadowaki T, Accili D, Taylor SI: Structural and functional analysis of the insulin receptor promoter. Mol Endocrinol 4:647-56, 1990

[22.] Tewari DS, Cook DM, Taub R: Characterization of the promoter region and the 3′ end of the human insulin receptor gene. J Biol Chem 264:16238-45, 1989

[23.] Sibley E, Kastelic T, Kelly TJ, Lane DM: Characterization of the mouse insulin receptor gene. Proc Natl Acad Sci USA 86:9732-36, 1989

[24.] Levy JR, Krystal G, Glickman P, Dastvan F: Effects of media conditions, insulin, and dexamethasone on insulin receptor mRNA and promoter activity in HepG2. Diabetes 40:58-65, 1991

[25.] Lee JK, Tam JWO, Tsai MJ, Tsai SY: Identification of cis- and trans-acting factors regulating the expression of the human insulin receptor gene. J Biol Chem 267:4638-45, 1992

[26.] Araki E, Murakami T, Shirotani T, Kanai F, Shinohara Y, Shimada F, Mori M, Shichiri M, Ebina Y: A cluster of four Sp1 binding sites required for effecient expression of the human insulin receptor gene. J Biol Chem 266:3944-48, 1991

[27.] Levy JR, Hug V: Nuclear protein binding analysis of a GC-rich insulin receptor promoter regulatory region. Diabetes 42:66-73, 1993

[28.] McKeon C, Pham T: Transactivation of the human insulin receptor gene by the CAAT/enhancer binding protein. Biochem Biophys Res Commun 174:721-28, 1991

[29.] Cameron KE, Resnik J, Webster NJG: Transcriptional regulation of the human insulin receptor promoter. J Biol Chem 267:17375-83, 1992

[30.] Pothier F, Ouellet M, Julien J-P, Guerin SL: An improved CAT assay for promoter analysis in either transgenic mice or tissue culture cells. DNA Cell Biology 11:83-90, 1992

[31.] Herbomel P, Bourachot B, Yaniv M: Two distinct enhancers with distinct cell-specificities coexist in the regulatory region of polyma. Cell 39:653-62, 1984

[32.] Sleigh MJ: A nonchromatographic assay for expression of the chloramphenicol acetyltransferase assays in extracts of transfected culture culture cells. Anal Biochem 156:251-56, 1986

[33.] Crabb DW, Dixon JE: A method for increasing the sensitivity of chloramphenicol acetyltransferase assays in extracts of transfected culture cells. Anal Biochem 163:88-92, 1987

[34.] Graves BJ, Johnson PF, McKnight SL: Homologous recognition of a promoter domain common to the MSV LTR and the HSV tk gene. Cell 44:565-76, 1986

[35.] Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K: Current Protocols in Molecular Biology. New York, Wiley-Interscience, 1988

[36.] Hoffman EK, Trusko SP, Murphy M, George DL: An S1 nuclease sensitive homopurine/homopyrimidine domain in the c-Ki-ras promoter interacts with a nuclear factor. Proc Natl Acad Sci USA 87:2705-709, 1990

[37.] Smale ST, Baltimore D: The “initiator” as a transcriptional control element. Cell 57:103-13, 1989

[38.] Hardon EM, Frain M, Paonessa G, Cortese R: Two distinct factors interact with the promoter regions of several liver-specific genes. EMBO J7:1711-19, 1988

[39.] Mueller CR, Maire P, Schibler U: DBP, a liver-enriched transcriptional activator is expressed late in ontogeny and its tissue specificity is determined posttranscriptionally. Cell 61:279-91, 1990

[40.] Fromental C, Kanno M, Nomiyama H, Chambon P: Cooperativity and heirachical levels of functional organization in the SV40 genome. Cell 54:943-53, 1988

[41.] Descombes P, Chojkier M, Lichtsteiner S, Falvey E, Schibler U:LAP, a novel member of the C/EBP gene family, encodes a liver-enriched transcriptional activator protein. Genes Dev 4:1541-51, 1990

[42.] Faisst S, Meyer S: Compilation of vertebrate-encoded transcription factors. Nucleic Acids Res 20:3-26, 1992

[43.] Saffer JD, Jackson SP, Annarella MB: Regulation of Sp1 during mouse development. Mol Cell Biol 11:2189-99, 1991

[44.] Iwama N, Saito Y, Nomura M, Imano E, Watarai T, Yamasaki Y, Kawamori R, Kamada T: 5′-flanking region of the human insulin receptor gene and long terminal repeat of mouse mammary tumor virus bind to the same nuclear protein. Diabetelogia 32:877-80, 1989

[45.] Brunetti A, Goldfine ID: Identification of nuclear binding proteins for the insulin receptor promoter. Diabetes 41 (Suppl. 1):55A, 1992

[46.] Akira S, Isshiki H, Sugita T, Tanabe O, Kinoshita S, Nishiro Y, Nakajima T, Hirano T, Kishimoto T: A nuclear factor for IL-6 expression (NF-IL6) is a member of a C/EBP family. EMBO J 9:1897-906, 1990

[47.] Poli V, Mancini FP, Cortese R: IL-6DBP, a nuclear protein involved in interleukin-6 signal transduction, defines a new family of leucine zipper proteins related to C/EBP. Cell 63:643-53, 1990

[48.] Gloss B, Yeo GM, Meisterenst M, Rogge L, Winnacker EL, Bernard HU: Clusters of nuclear factor 1 binding sites identify enhancers of several papillomaviruses but alone are not sufficient for enhancer function. Nucleic Acids Res 17:3519-33, 1989

[49.] Paonessa G, Gounari F, Frank R, Cortese R: Purification of a NF 1-like DNA-binding protein from rat liver and cloning of the corresponding cDNA. EMBO J 7:3115-23, 1988

[50.] Gil G, Smith JR, Goldstein JL, Slaughter CA, Orth K, Brown MS, Osbourne TF: Multiple genes encode nuclear factor 1-like proteins that bind to the promoter for 3-hydroxy-3-methylglutaryl-coenzyme A reductase. Proc Natl Acad Sci USA 85:8963-67, 1988

[51.] Rupp RA, Kruse U, Multhaup G, Gobel U, Beyreuther K, Sippel AE: Chicken NF1/TGGCA proteins are encoded by at least three independent genes: NF1-A, NF1-B, and NF1-C with homologies in mammalian genomes. Nucleic Acids Res 18:2607-16, 1990

[52.] Graves RA, Tontonoz P, Ross SR, Spiegelman BM: Identification of a potent adipocyte-specific enhancer: involvement of an NF-1-like factor. Genes Dev 5:428-37, 1991

COPYRIGHT 1994 American Diabetes Association

COPYRIGHT 2004 Gale Group