Common cholesteryl ester transfer protein gene polymorphisms and the effect of atorvastatin therapy in type 2 diabetes

Common cholesteryl ester transfer protein gene polymorphisms and the effect of atorvastatin therapy in type 2 diabetes – Pathophysiology/Complications: Original Article

Francine V. van Venrooij

OBJECTIVE–The cholesteryl ester transfer protein (CETP) plays a key role in the remodeling of triglyceride (TG)-rich and HDL particles. Sequence variations in the CETP gene may interfere with the effect of lipid-lowering treatment in type 2 diabetes.

RESEARCH DESIGN AND METHODS–We performed a 30-week randomized double-blind placebo-controlled trial with atorvastatin 10 mg (A10) and 80 mg (A80) in 217 unrelated patients with diabetes.

RESULTS–CETP TaqIB and A-629C polymorphisms were tightly concordant (P < 0.001). At baseline, B1B1 carriers had lower plasma HDL cholesterol (0.99 [+ or -] 0.2 vs. 1.11 [+ or -] 0.2 mmol/l, P < 0.05), higher CETP mass (2.62 [+ or -] 0.8 vs. 2.05 [+ or -] 0.4 mg/l, P < 0.001), and slightly increased, though not significant, plasma TGs (2.7 [+ or -] 1.05 vs. 2.47 [+ or -] 0.86, P = 0.34) compared with B2B2 carriers. Atorvastatin treatment significantly reduced CETP mass dose-dependently by 18% (A10) and 29% (A80; both vs. placebo P < 0.001, A10-A80 P < 0.001). CETP mass and activity were strongly correlated (r = 0.854, P < 0.0001). CETP TaqIB polymorphism appeared to modify the effect of atorvastatin on HDL cholesterol elevation (B1B1 7.2%, B1B2 6.1%, B2B2 0.5%; P < 0.05), TG reduction (B1B1 39.7%, B1B2 38.4%, B2B2 18.4%; P = 0.08), and CETP mass reduction (B1B1 32.1%, B1B2 29.6%, B2B2 21.9%; P = 0.27, NS). Similar results were obtained for the A-629C polymorphism.

CONCLUSIONS–In conclusion, the B1B1/CC carriers of the CETP polymorphisms have a more atherogenic lipid profile, including low HDL, and they respond better to statin therapy. These results favor the hypothesis that CETP polymorphisms modify the effect of statin treatment and may help to identify patients who will benefit most from statin therapy.

**********

Cholesteryl ester transfer protein (CETP) plays a key role in lipoprotein metabolism, promoting the exchange of triglycerides (TGs) and cholesteryl esters (CEs) between lipoprotein particles, resulting in both a net transfer of CEs from HDL cholesterol to apolipoprotein B (apoB)-containing lipoproteins and a subsequent uptake of cholesterol by hepatocytes (1). This reverse cholesterol transport is considered an antiatherogenic phenomenon. However, in the presence of elevated TG concentrations, an increased CE/TG transfer may induce the formation of smaller-sized LDL particles and decreased HDL cholesterol levels (2,3), providing a proatherogenic property of the action of CETP (4,5). The lipoprotein profile in type 2 diabetes is characterized by the presence of increased TG-rich lipoprotein remnant particles, small dense LDL particles, and decreased levels of HDL cholesterol. These conditions favor an increased transfer of CE from HDL (6-8). However, reports on CETP mass and activity in type 2 diabetes appear to be conflicting (9-11). These differences may be explained by differences in baseline plasma TG concentrations in the study populations (6,12).

Genetic heterogeneity at the CETP gene locus is associated with plasma CETP activity and HDL cholesterol levels. The most frequently studied polymorphism is a silent base change affecting the 277th nucleotide in the first intron of the gene, resulting in the disruption of a restriction site for the enzyme TaqI. The B2 allele (absence of the TaqI restriction site) has been associated in normolipidemic subjects with increased HDL cholesterol levels and decreased CETP activity and mass. An association between the TaqIB genotype and progression of coronary heart disease (CHD) after pravastatin therapy was found in men with angiographically documented coronary atherosclerosis (13). This CETP polymorphism may thus affect the response to cholesterol-lowering treatment. In the Framingham cohort, men with the B2 allele had a lower CHD risk (14). In line with these results, it has been observed that male patients with type 2 diabetes and the CETP B2B2 genotype may have a decreased risk for coronary artery disease (CAD ) progression (11). Recently, a new polymorphism was described, located at–629 (A-629C) in the promoter region of the CETP gene. The A allele was associated with 25% lower transcription activity in vitro (15), whereas in vivo, individuals with the A-allele had lower plasma CETP mass and increased HDL cholesterol levels. This polymorphism appeared in linkage disequilibrium with the CETP TaqIB polymorphism in nondiabetic European Caucasian men with cardiovascular disease (15,16). Additional less-frequently occurring CETP gene polymorphisms have been extensively studied as well (16). The latter study nicely illustrates the complexity of gene-phenotype interactions, and it illustrates the importance of strong additional influences of environmental factors on plasma lipid traits.

The aim of the present study was to investigate the role of the frequently occurring CETP TaqIB and A-629C gene polymorphisms on the efficacy of atorvastatin treatment in patients with type 2 diabetes taking part in the Diabetes Atorvastatin Lipid Intervention (DALI) study. We hypothesize that the highly concordant genetic variation in the CETP gene promoter region at -629 could explain the observed associations of the TaqIB variant with respect to the lipid-lowering effect of statin treatment in type 2 diabetes.

RESEARCH DESIGN AND METHODS–This study comprised all patients enrolled in the DALI study. DALI is a double-blind, randomized, placebo controlled, multicenter study evaluating the effect of atorvastatin 10 mg (A10) vs. 80 mg (A80) on lipid metabolism, endothelial function, coagulation, and inflammatory factors in unrelated men and women with type 2 diabetes. The protocol and eligibility criteria have been described in detail elsewhere (17). Briefly, men and women aged 45-75 years with a duration of diabetes of at least 1 year and [HbA.sub.1c] [less than or equal to]10% were eligible. The diagnosis type 2 diabetes was defined according to the American Diabetes Association classification (18). Lipid inclusion criteria were total cholesterol (TC) between 4.0 and 8.0 mmol/l and fasting TGs between 1.5 and 6.0 mmol/l. Patients were recruited in Leiden, Rotterdam, and Utrecht, the Netherlands. Of the study population, 84% was of Caucasian origin. The study protocol was approved by the ethical committees of the part icipating centers, and written informed consent was obtained from all subjects.

Laboratory measurements

After an overnight fast for a minimum of 12 h, blood was drawn for analysis of lipid profiles. Plasma was prepared by immediate centrifugation. Lipids and apos were quantified as extensively described elsewhere (17). Plasma CETP mass was analyzed as described (19). We used a two-antibody sandwich immunoassay with a combination of the monoclonal antibodies TP1 and TP2 as coating and TP20 as secondary antibody, labeled with digoxigenine. The intra- and interassay coefficients of variance were 7.8 and 6.0%, respectively. The CETP control samples were validated using a radioactive immunoassay (kindly performed by Dr. R.M. McPherson, Montreal, Canada). Plasma CETP activity was measured as described elsewhere (20). CETP activity is expressed relative to the activity in a reference pool plasma (%).

DNA analysis

Blood for DNA analysis was collected at baseline, and DNA was isolated according to standard procedures (21). For the CETP TaqIB polymorphism, the following primers were used: 5′-ACATATTAAGCAATTATCCAGAT-3′ (sense), 5’CACTTGTGCAACCCATACTTGACT3′ (antisense). The PCR was performed in 100 [mu]l containing 500 ng genomic DNA, 0.1 mmol/l of each dNTP, 2.6 units of Expand high fidelity Taq polymerase (Boehringer Mannheim, Mannheim, Germany), 10% reaction buffer, and 100 pmol of each primer. The PCR conditions were as follows: denaturation for 5 min at 94[degrees]C, 30 cycles of denaturation for 1 mm at 94[degrees]C, annealing for 1 mm at 50[degrees]C, extension for 1 mm at 72[degrees]C, and a final extension of 10 mm at 72[degrees]C. The final product was 1,420 bp. After digestion with TaqI (10 units) for 2 h at 65[degrees]C, the final product was resolved on 1% agarose gel. After restriction, two fragments (670 and 750 bp) were found. This genotype was referred to as BlBl. For the A-629C polymorphism, the following primers were used: 5′-TTCTTGGCCCCAGCTGTAGG-3′ (sense) and 5’GAAACAGTCCTCTATGTAGACTTTCCTTGATATGCATAAAATACCACTGG-3′ (antisense). The PCR was performed in 25 [mu]l containing 100 ng DNA, 2.5 [mu]mol/l of each primer, 0.4 mmol/l of each dNTP, 0.5 units Supertaq (Amersham), and 10% reaction buffer. The PCR conditions were as follows: denaturation for 5 mm at 94[degrees]C followed by 30 cycles of denaturation for 1 mm at 94[degrees]C, annealing for 1 mm at 62[degrees]C, and extension for 30s at 72[degrees]C. The final product was 232 bp. After restriction with Van91 I and analysis on 4% Metaphore agarose (Biozyme), two fragments were resolved from 47 and 175 bp. This genotype was referred to as AA.

Statistical analysis

All data were analyzed by intention-to-treat. Mean differences between the study groups (either treatment or genotype groups) were analyzed using ANCOVA, adjusted for baseline levels and study location. Additional adjustments for potential confounders (e.g., smoking, alcohol use, and sex) were performed by including these as covariates. When logarithmic transformation was applied to parameters with skewed distributions, similar results were obtained. Additional explanatory analyses were performed by including interaction terms into the model. Within each of the treatment groups, the assumption of Hardy-Weinberg equilibrium was tested by means of gene counting and [chi square] analyses. Linkage disequilibrium was calculated using the programs EH and Arlequin. Pearson correlation coefficients were calculated to study associations between plasma CETP mass and lipid variables at baseline. Spearman’s correlation coefficients were calculated to study associations between plasma CETP mass and CETP polymorphisms. All analyses were performed using SPSS software version 9.0 for Windows.

RESULTS

Frequencies of the CETP TaqIB and A-629C polymorphism

From 212 patients, DNA was analyzed for CETP TaqIB polymorphism, and 215 samples were available for analysis of A-629C polymorphism. The allele frequencies for the TaqIB and A-629C polymorphism in the total cohort was 0.571 for the Bl allele and 0.501 for the C allele. These frequencies were similar among the three treatment groups. The observed genotype frequencies were in HardyWeinberg equilibrium. Both polymorphisms were in tight but not complete linkage disequilibrium (D = 0.21287; D’ = 0.9661). The majority of the carriers of the B1B1 genotype were carriers of the CC genotype (Table 1). Because 16% of the patients were of non-Caucasian origin, we performed additional analyses for Caucasian patients only and revealed similar results. The other groups were not analyzed separately because of the small numbers.

Baseline characteristics according to genotype

When the patients were classified according to their TaqIB or A-629C genotype, no statistically significant differences between groups at baseline were found with respect to patient characteristics and diabetes-related variables (Table 2). However, patients with the B1B1 genotype had a more severe atherogenic lipoprotein profile (Table 2). B1B1 carriers had significantly decreased HDL cholesterol levels (0.99 [+ or -] 0.2 vs. 1.11 [+ or -] 0.2 mmol/l, P < 0.01 vs. B2B2). This was apparent in both men and women. B1B1 carriers had significantly increased plasma CETP mass (2.62 [+ or -] 0.81 vs. 2.05 [+ or -] 0.40 mg/l, P < 0.001 vs. B2B2). Plasma TG levels were higher in B1B1 carriers, although this difference did not reach the level of statistical significance. Similarly, carriers with the B2B2 genotype had significantly lower plasma CETP mass than B1B2 carriers (2.51 [+ or -] 0.20 mg/l, P < 0.001). No differences were found in TC, LDL cholesterol, free fatty acid (FFA), apoB, and lipoprotein A-I (LpA-I) conce ntrations. Similar observations were found with stratification for the A-629C polymorphism (Table 2).

Plasma CETP mass was associated with both the A-629C (allele C present: r = 0.355, P < 0.001) and CETP TaqIB polymorphisms (allele B1 present: r = 0.326, P < 0.001), TC (r = 0.209, P < 0.01), apoB (r = 0.216, P < 0.01), LDL cholesterol (r = 0.174, P < 0.05), HDL cholesterol (r = -0.184, P < 0.01), and TG (r = 0.163, P < 0.05) but not with FFA and LpA-I, thereby illustrating the fact that genetic polymorphisms are not the only determinant for plasma CETP mass levels.

Effect of atorvastatin treatment

The baseline characteristics of the DALI study population and the effects of A10 and A80 on the main lipid parameters have been described extensively elsewhere (17). In short, administration of Al0 or A80 resulted in a 25 and 35% decrease, respectively, in plasma TG, whereas plasma LDL cholesterol decreased with 40 and 52%, respectively (Table 3). After 10 weeks, A10 and A80 significantly lowered plasma CETP mass when compared with placebo (P < 0.001) (Fig. 1). This effect on CETP mass was dose-dependent (18% after A10 vs. 29% afterA80 treatment, P < 0.001;A10 vs. A80, P < 0.00 1). CETP activity was analyzed in a subgroup. In this randomly selected subset, plasma CETP activity was analyzed before and after treatment with atorvastatin. Both at baseline and after treatment, plasma CETP mass was highly significantly correlated with CETP activity (baseline r 0.685 P < 0.001, after treatment r = 0.854; P < 0.000 1) (Fig. 2).

Effect of atorvastatin according to genotype

CETP TaqIB polymorphism appeared to modulate the effect of atorvastatin on plasma HDL cholesterol (Fig. 3). In carriers with the B1B1 genotype, HDL cholesterol levels increased 8.4% after A10 and 7.2% after A80, whereas in B2B2 carriers, atorvastatin had no effect on HDL cholesterol (allele Bl present versus allele Bl absent, P 0.5).

CONCLUSIONS–In the present study, we investigated whether the common CETP TaqIB and A-629C polymorphisms in the CETP gene were associated with plasma lipid variables and involved in the efficacy of atorvastatin treatment in type 2 diabetes. The gene frequencies for the TaqIB polymorphism in our study cohort were similar to those reported in other Caucasian (14) and type 2 diabetic (11) populations. The CETP A-629C polymorphism has only been evaluated in two other studies in which similar genotype frequencies were observed (15,16). In all of these studies, the TaqIB and the A-629C polymorphisms were in strong though not complete linkage disequilibrium (Table 1), supporting the hypothesis that the A-629C variant, located in the promoter region of the CETP gene promoter, might explain the observed relationships. Recently, a new promoter polymorphism has been described by Le Goff et al. (22) located at position -971. However, in vitro analyses revealed that the -971 G/A polymorphism does not modulate CETP transc riptional activity. Many other potentially important CETP variants have been described (16). However their genotype frequencies were very low and therefore excluded as putative candidates to explain the observed associations.

Carriers with the B1B1 and the CC genotype have atherogenic diabetic dyslipidemia, whereas the B2B2 variant carriers exhibit a milder form of dyslipidemia. B1B1 carriers have increased plasma CETP mass and activity as well as decreased plasma HDL cholesterol and apoA-I concentrations compared with heterozygous (B1B2 or AC) and homozygous (B2B2 or AA) carriers of the mutant allele. In our study, the effect of CETP polymorphisms on CETP mass and HDL cholesterol levels was independent of sex, which is in agreement with results in the Framingham study. However, two other reports were published showing only an effect of TaqIB in a Finnish population cohort in women (23) or in men with type 2 diabetes (11). In the Framingham cohort, the association between CETP gene polymorphism and HDL cholesterol was found in both men and women, but men with the B2 allele only show a protective effect on CHD (14). Additional statistical analysis revealed that the concentration of plasma CETP mass is dependent not only on the pres ence of genetic variation in the CETP gene but also on the concentrations of plasma TC, apoB, LDL cholesterol, HDL cholesterol, and TGs. Genetic variation in the CETP gene will thus explain only part of the variation observed in plasma CETP levels (13). The mechanism behind the observed associations is still not understood. Because the TaqIB variant is located in intron 1 of the CETP gene, it is unlikely that this polymorphism constitutes a functional mutation. Instead, the observed associations are likely to be explained by a newly described functional genetic variation in the promoter region of the CETP gene (15), A-629C, which is in strong linkage disequilibrium with the TaqlB polymorphism. In in vitro transfection studies, it was demonstrated that the presence of the A allele resulted in a decreased (25%) transcriptional activity of the CETP promoter by disrupting a possible consensus sequence site for Sp1 and Sp3 transcription factors. Furthermore, it has been shown that plasma CETP mass is independently determined by both the TaqIB/A-629C polymorphisms and the C405/G524T polymorphisms in the CETP gene (16). The latter polymorphisms could not be analyzed in our cohort because of the lower genotype frequency. Furthermore, transcriptional regulation of CETP synthesis occurs and may influence the homeostasis of plasma CETP (24, 25). It is therefore not surprising that genetic variation in the CETP gene does not completely explain the variability in plasma CETP mass.

The TaqIB and the A-629C CETP polymorphisms appeared to modulate the effect of atorvastatin on plasma lipid variables (Fig. 2). B1B1 and/or the CC carriers, with higher baseline CETP mass and a more atherogenic lipoprotein profile (lower HDL cholesterol and increased plasma TGs), appear to benefit most from lipid-lowering therapy. Others observed higher baseline CAD risk in B1B1 carriers and diminished progression of coronary atherosclerosis in B1B1 carriers compared with B2B2 carriers after 2 years of pravastatin therapy in nondiabetic men with CAD (13). Although no difference in efficacy of statin treatment on HDL cholesterol and TG levels between the TaqIB genotypes was found, B1B1 carriers appeared to benefit most from statin therapy with respect to morphologic changes in coronary arteries (13). This may apply to subjects with type 2 diabetes as well (11). We further analyzed whether the modifying effect of CETP polymorphisms on the efficacy of atorvastatin treatment is a direct consequence of the fact th at these two CETP polymorphisms have a major contribution to the level of plasma CETP mass. However, additional analysis showed that baseline CETP mass did not influence the efficacy of atorvastatin treatment.

In a subset of the present study cohort, we were able to analyze both CETP mass and CETP activity to test the hypothesis that both activity and mass are affected to a similar extent by the treatment. At baseline, these two parameters were highly significantly correlated. After treatment with atorvastatin, an even stronger correlation between CETP mass and activity was observed. In the present study, we show that plasma CETP mass is significantly and dose-dependently reduced after statin therapy in patients with type 2 diabetes and dyslipidemia. The basic effect of statin treatment is the large reduction in plasma TC and LDL cholesterol, with an accompanied decrease in plasma TG levels, by inhibition of the enzyme hydroxymethylglutaryl-CoA reductase. The result of this action is a change in cellular cholesterol homeostasis. To provide the cell with enough cholesterol, the LDL receptor expression will be upregulated, facilitating enhanced lipoprotein clearance and uptake of cholesterol in the hepatocyte. Sterol regulatory element binding protein-1 (SREBP-1), a membrane-bound transcription factor, plays an important role in this process (26). In addition, the secretion of newly synthesized VLDL particles may be decreased by statins, resulting in lower plasma VLDL and TG levels. This lowering of the plasma levels of circulating TG donor particles for CETP-mediated TG/CE exchange results in a decreased input of CEs into circulating VLDL and LDL. Statin treatment may also result in a downregulation of CETP gene expression by interference with the SREBP pathway. SREBP-1a is known to bind with the sterol regulatory element present in the promoter region of the CETP gene (27,28). CETP may also be regulated by direct activation of transcription via SREBP-1independent pathways, as has been indicated in CETP transgenic mice (27).

In conclusion, we demonstrated in type 2 diabetic patients that B1B1 and CC carriers (of the TaqIB and A-629C polymorphisms, respectively) are associated with elevated CETP mass and low HDL cholesterol concentrations. Atorvastatin dose-dependently reduced CETP mass in these patients. The efficacy of lipid-lowering therapy with atorvastatin may be modified by these polymorphisms with respect to HDL cholesterol and fasting TG levels, which together are the key characteristics of the atherogenic lipid profile in diabetic dyslipidemia. The relevance of this finding is emphasized by the high frequency of these polymorphisms in Caucasian populations: 34% of our population had the B1B1 genotype and 25% the CC genotype. These genetic variants of the CETP gene may help to identify those diabetic patients with increased cardiovascular risk, who may benefit most from statin therapy.

APPENDIX — The DALI-study group participants are (in alphabetical order): I. Berk-Planken, N. Hoogerbrugge, and H. Jansen (Department of Internal Medicine, Erasmus Medical Center Rotterdam, Rotterdam); H. Jansen (Departments of Biochemistry and Clinical Chemistry); H.M.G. Princen (Gaubius Laboratory. TNO-PG, Leiden); M.V. Huisman and M.A. van de Ree (Leiden University Medical Center, Leiden); R.P. Stolk and F.V. van Venrooij (Julius Center for General Practice and Patient Oriented Research, University Medical Center Utrecht); and J.D. Banga, G. Dallinga-Thie, and F.V. van Venrooij (Division of Internal Medicine, University Medical Center Utrecht, Utrecht, the Netherlands).

[FIGURE 1 OMITTED]

[FIGURE 2 OMITTED]

[FIGURE 3 OMITTED]

Table 1

Genotype sharing of CETP TaqIB and A-629C polymorphisms in type 2

diabetes

CETP Taq IB A-629A A-629C C-629C

B1B1 1 19 52

B1B2 10 85 2

B2B2 39 3 0

Data are n.

Table 2

Baseline characteristics of patients included in the DALI study,

according to CETP Taq1B genotype (B1B1, B1B2, and B2B2) and CETP A-629C

promoter polymorphism (CC, AC, and AA)

B1B1 B1B2

n (%) 72 (34) 98 (46)

Male sex (%) 37 43

Age (years) 59.3 [+ or -] 7.4 59.3 [+ or -] 7.7

Blood pressure (mmHg) 146/85 145/85

Diabetes duration (years) 10.3 [+ or -] 7.1 12.8 [+ or -] 8.1

[HbA.sub.1c] (%) 8.2 [+ or -] 1.1 8.4 [+ or -] 1.1

Fasting glucose (mmol/l) 10.3 [+ or -] 2.4 10.8 [+ or -] 3.7

BMI (kg/[m.sup.2]) 30.6 [+ or -] 4.9 31.2 [+ or -] 5.3

Waist-to-hip ratio 1.00 [+ or -] 0.08 1.00 [+ or -] 0.09

Present smoking (%) 41 44

Present alcohol use (%) 74 81

Total cholesterol (mmol/l) 5.8 [+ or -] 0.8 6.1 [+ or -] 0.9

LDL cholesterol (mmol/l) 3.6 [+ or -] 0.8 3.8 [+ or -] 0.9

HDL cholesterol (mmol/l) 0.99 [+ or -] 0.2 1.05 [+ or -] 0.2

Triglycerides (mmol/l) 2.72 [+ or -] 1.05 2.71 [+ or -] 0.98

FFA (mmol/l) 0.68 [+ or -] 0.24 0.67 [+ or -] 0.26

apoB (g/l) 1.23 [+ or -] 0.20 1.25 [+ or -] 0.22

LpA-1 (g/l) 0.43 [+ or -] 0.13 0.46 [+ or -] 0.13

CETP mass (mg/l) 2.62 [+ or -] 0.81 2.51 [+ or -] 0.59

B2B2 P

n (%) 42 (20)

Male sex (%) 19

Age (years) 59.9 [+ or -] 7.8 NS, >0.8

Blood pressure (mmHg) 145/85 NS, >0.8

Diabetes duration (years) 11.0 [+ or -] 6.9 NS, >0.8

[HbA.sub.1c] (%) 8.4 [+ or -] 1.1 NS, >0.2

Fasting glucose (mmol/l) 10.4 [+ or -] 3.3 NS, >0.4

BMI (kg/[m.sup.2]) 30.9 [+ or -] 4.4 NS, >0.4

Waist-to-hip ratio 1.01 [+ or -] 0.1 NS, >0.8

Present smoking (%) 41

Present alcohol use (%) 80

Total cholesterol (mmol/l) 6.0 [+ or -] 0.9 NS, 0.16

LDL cholesterol (mmol/l) 3.8 [+ or -] 0.9 NS, 0.31

HDL cholesterol (mmol/l) 1.11 [+ or -] 0.2 * 0.01 vs. B1B1 *

Triglycerides (mmol/l) 2.47 [+ or -] 0.86 NS, 0.34

FFA (mmol/l) 0.62 [+ or -] 0.28 NS, 0.52

apoB (g/l) 1.25 [+ or -] 0.22 NS, 0.69

LpA-1 (g/l) 0.46 [+ or -] 0.12 NS, 0.284

CETP mass (mg/l) 205 [+ or -] 0.40 * + <0.001 vS. B1B1, *

<0.001 vs. B1B2 +

CC AC

n (%) 54 (25) 109 (51)

Male sex (%) 57 50

Age (years) 60.2 [+ or -] 7.5 59.2 [+ or -] 7.7

Blood pressure (mmHg) 146/86 146/85

Diabetes duration (years) 9.9 [+ or -] 7.4 11.9 [+ or -] 7.4

[HbA.sub.1c] (%) 8.1 [+ or -] 1.0 8.4 [+ or -] 1.1

Fasting glucose (mmol/l) 10.2 [+ or -] 2.2 10.7 [+ or -] 3.2

BMI (kg/[m.sup.2]) 30.8 [+ or -] 4.5 31.2 [+ or -] 5.4

Waist-to-hip ratio 1.01 [+ or -] 0.08 0.99 [+ or -] 0.09

Present smoking (%) 40 41

Present alcohol use (%) 77 76

Total cholesterol (mmol/l) 5.8 [+ or -] 0.8 6.1 [+ or -] 0.9

LDL cholesterol (mmol/l) 3.6 [+ or -] 0.8 3.8 [+ or -] 0.9

HDL cholesterol (mmol/l) 1.01 [+ or -] 0.2 1.03 [+ or -] 0.2

Triglycerides (mmol/l) 2.70 [+ or -] 1.07 2.73 [+ or -] 0 98

FFA (mmol/l) 0.69 [+ or -] 0.26 0.64 [+ or -] 0.22

apoB (g/l) 1.23 [+ or -] 0.21 1.26 [+ or -] 0.22

LpA-1 (g/l) 0.45 [+ or -] 0.14 0.45 [+ or -] 0.12

CETP mass (mg/l) 2.64 [+ or -] 0.77 2.55 [+ or -] 0.65

AA P

n (%) 52 (24)

Male sex (%) 56

Age (years) 59.6 [+ or -] 7.4 NS, >0.8

Blood pressure (mmHg) 144/86 NS, >0.8

Diabetes duration (years) 12.3 [+ or -] 7.8 NS, >0.18

[HbA.sub.1c] (%) 8.4 [+ or -] 1.2 NS, >0.3

Fasting glucose (mmol/l) 10.5 [+ or -] 4.0 NS, >0.6

BMI (kg/[m.sup.2]) 30.4 [+ or -] 4.4 NS, >0.6

Waist-to-hip ratio 1.01 [+ or -] 0.1 NS, >0.8

Present smoking (%) 45

Present alcohol use (%) 84

Total cholesterol (mmol/l) 5.9 [+ or -] 0.8 NS, 0.22

LDL cholesterol (mmol/l) 3.7 [+ or -] 0.8 NS, 0.28

HDL cholesterol (mmol/l) 1.1 [+ or -] 0.2 * <0.05 vs. CC *

Triglycerides (mmol/l) 2.48 [+ or -] 0.88 NS, 0.30

FFA (mmol/l) 0.68 [+ or -] 0.32 NS, 0.34

apoB (g/l) 1.23 [+ or -] 0.20 NS, 0.56

LpA-1 (g/l) 0.46 [+ or -] 0.13 NS, >0.8

CETP mass (mg/l) 2.07 [+ or -] 0.42 * + <0.001 vs. CC, *

<0.001 vs. AC +

Data are means [+ or -] SD, unless otherwise noted.

Table 3

Plasma lipid variables in type 2 diabetes after 30 weeks’ statin

treatment +

Placebo 10 mg Atorva

Cholesterol

Week 0 6.0 [+ or -] 0.1 5.9 [+ or -] 0.1

Week 30 6.0 [+ or -] 0.1 4.1 [+ or -] 0.1 *

LDL-C

Week 0 3.8 [+ or -] 0.1 3.7 [+ or -] 0.1

Week 30 3.6 [+ or -] 0.1 2.2 [+ or -] 0.1 *

HDL-C

Week 0 1.05 [+ or -] 0.02 1.05 [+ or -] 0.03

Week 30 1.04 [+ or -] 0.03 1.10 [+ or -] 0.04

Triglycerides

Week 0 2.62 [+ or -] 0.11 2.51 [+ or -] 0.10

Week 30 2.88 [+ or -] 0.22 1.84 [+ or -] 0.10 *

80 mg Atorva

Cholesterol

Week 0 6.0 [+ or -] 0.1

Week 30 3.6 [+ or -] 0.1 *

LDL-C

Week 0 3.7 [+ or -] 0.1

Week 30 1.7 [+ or -] 0.1 *

HDL-C

Week 0 1.03 [+ or -] 0.03

Week 30 1.09 [+ or -] 0.04

Triglycerides

Week 0 2.85 [+ or -] 0.13

Week 30 1.78 [+ or -] 0.16 *

Data are means [+ or -] SE. All lipid parameters are expressed as

mmol/l.

* P < 0.001, test for differences among the three groups, adjusted for

baseline value and study location.

+ For extended details see reference (17).

Acknowledgments– The study was supported by an unrestricted grant from Parke-Davis, the Netherlands.

The authors thank all individuals who have contributed to the study as patient, technician, or data manager. We greatly acknowledge Mirjam Herreilers for the CEIP TaqIB genotyping. We are grateful to referring physicians in the following hospitals (in alphabetical order): Albert Schweitzer Hospital (Zwijndrecht). Antonius Hospital (Nieuwegein), Diaconessenhuis (Leiden), Diakonessen Hospital (Utrecht), General practitioner Center De Greev (Utrecht), Ikazia Hospital (Rotterdam), Lorenz Hospital (Zeist), Oudenrijn Hospital (Utrecht), Rijnland Hospital (Leiderdorp), and St. Franciscus Gasthuis (Rotterdam, the Netherlands).

Received for publication 23 July 2002 and accepted in revised form 30 December 2002.

References

(1.) Yamashita S, Hirano K, Sakai N, Matsuzawa Y: Molecular biology and patho-physiological aspects of plasma cholesteryl ester transfer protein. Biochim Biophys Acta Mol Cell Biol Lipids 1529:257-275, 2000

(2.) McPherson R, Mann CJ, Tall AR, Hogue M, Martin L, Milne RW, Marce YL: Plasma concentrations of cholesteryl ester transfer protein in hyperlipoproteinemia. Arterioscler Thromb 11:797-803, 1991

(3.) Tall AR: Plasma cholesteryl transfer protein. J Lipid Res 34:1255-1275, 1993

(4.) Morton RE: Cholesteryl ester transfer protein and its plasma regulator: lipid transfer inhibitor protein. Curr Opin Lipidol 10: 321-327, 1999

(5.) Swenson TL: Transfer proteins in reverse cholesterol transport. Curr Opin Lipidol 3:67-74, 1992

(6.) Guerin M, Le Goff W, Lassel TS, Van Tol A, Steiner G, Chapman MJ: Proatherogenic role of elevated cholesteryl ester transfer from HDL to VLDL1 and dense LDL in type 2 diabetes: impact of the degree of triglyceridemia. Arterioscler Thromb Vasc Biol 2 1:282-288, 2001

(7.) Riemens S, Van Tol A, Sluiter W, Dullaart R: Elevated plasma cholesteryl ester transfer in NIDDM: relationships with apolipoprotein B-containing lipoproteins and phospholipid transfer protein. Atherosclerosis 140:71-79, 1998

(8.) Bhatnagar D, Durrington P, Kumar S, Mackness MI, Dean J, Boulton AJ: Effect of treatment with a hydroxymethylglutaryl coenzyme A reductase inhibitor on fasting and postprandial plasma lipoproteins and cholesteryl ester transfer activity in patients with NIDDM. Diabetes 44: 460-465, 1995

(9.) Desrumaux C, Athias A, Bessede G, Verges B, Farnier M, Persegol L, Gambert P, Lagrost L: Mass concentration of plasma phospholipid transfer protein in normolipidemic, type IIa hyperlipidemic, type IIa hyperlipidemic, and non-insulin-dependent diabetic subjects as measured by a specific ELISA. Arterioscler Thromb Vasc Biol 19:266-275, 1999

(10.) Lottenberg SA, Lottenberg AM, Nunes VS, McPherson R, Quintao BC: Plasma cholesteryl ester transfer protein concentration, high-density lipoprotein cholesterol esterification and transfer rates to lighter density lipoproteins in the fasting state and after a test meal are similar in type II diabetics and normal controls. Atherosclerosis 127:81-90, 1996

(11.) Durlach A, Clavel C, Girard-Globa A, Durlach V: Sex-dependent association of a genetic polymorphism of cholesteryl ester transfer protein with high-density lipoprotein cholesterol and macrovascular pathology in type II diabetic patients. J Clin Endocrinol Metab 84:3656-3659, 1999

(12.) Kahri J, Syvanne M, Taskinen MR: Plasma cholesteryl ester transfer protein activity in non-insulin-dependent diabetic patients with and without coronary artery disease. Metabolism 43:1498-1 502, 1994

(13.) Kuivenhoven JA, Jukema JW, Zwinderman AH, de KP, McPherson R, Bruschke AV, Lie KI, Kastelein JJ: The role of a common variant of the cholesteryl ester transfer protein gene in the progression of coronary atherosclerosis: the Regression Growth Evaluation Statin Study Group [see comments]. N Engl J Med 338:86-93, 1998

(14.) Ordovas J, Cupples LA, Corella D, Otvos JD, Osgood D, Martinez A, Lahoz C, Coltell O, Wilson PW, Schaefer EJ: Association of cholesteryl ester transfer protein-TaqIB polymorphism with variations in lipoprotein subclasses and coronary heart disease risk: the Farmingham study. Arterioscler Thromb Vasc Biol 20:1323-1329, 2000

(15.) Dachet C, Poirier 0, Cambien F, Chapman J, Rouis M: New functional promoter polymorphism, CETP/-629, in cholesteryl ester transfer protein (CETP) gene related to CETP mass and high density lipoprotein cholesterol levels: role of Spl/Sp3 in transcriptional regulation. Arterioscler Thromb Vasc Biol 20:507-515, 2000

(16.) Corbex M, Poirier O, Fumeron F, Betoulle D, Evans A, Ruidavets JB, Arveiler D, Luc G, Tiret L, Cambien F: Extensive association analysis between the CETP gene phenotypes reveals several putative functional polymorphisms and gene-environment interaction. Genet Epidemiol 19:64-80, 2000

(17.) The Diabetes Atorvastatin Lipid Intervention (DALI) Study Group: The effect of aggressive versus standard lipid lowering by atorvastatin on diabetic dyslipidemia: the DALI study: a double-blind randomized, placebo-controlled trial in patients with type 2 and diabetic dyslipidemia. Diabetes Care 24:1335-1341, 2001

(18.) The Expert Committee on the Diagnosis and Classification of Diabetes Mellitus: Report of the Expert Committee on the Diagnosis and Classification of Diabetes Mellitus. Diabetes Care 20:1183-1197, 1997

(19.) Niemeijer-Kanters SDJM, Dallinga-Thie GM, Ruijter-Heijstek FC, Aigra A, Erkelens DW, BangaJD,Jansen H: Effect of intensive lipid-lowering strategy on lowdensity lipoprotein particle size in patients with type 2 diabetes mellitus. Atherosclerosis 156:209-216, 2001

(20.) Speijer H, Groener JE, van Ramshorst E, Van Tol A: Different locations of cholesteryl ester transfer protein and phospholipid transfer protein activities in plasma. Atherosclerosis 90:159-168, 1991

(21.) Miller SA, Dykes DD, Polesky HF: A simple salting out procedure for extracting DNA from human nucleated cells. NucI Acids Res 16:1215, 1988

(22.) Le Goff W, Guerin M, Nicaud V, Dachet C, Luc G, Arveiler D, RuidavetsJ-B, Evans A, Kee F, Morrison C, Chapman MJ, ThilletJ: A novel cholesteryl ester transfer protein promoter polymorphism (-971 G/A) associated with plasma high-density lipoprotein cholesterol levels. Interaction with the Taq !B and -629 C/A polymorphisms. Atherosclerosis 161:269-279,2002

(23.) Kauma H, Sarvolainen MJ, Heikkila R, Rantala A, Lilja M, Reunanen A, Kesaniemi YA: Sex difference in the regulation of plasma high density lipoprotein cholesterol by genetic and environmental factor. Hum Genet 97:156-162, 1996

(24.) Oliveira HCF, Choulnard RA, Agellon LB, Bruce C, Ma LM, Walsh A, Breslow JL, Tall AR: Human cholesteryl ester transfer protein gene proximal promoter contains dietary cholesterol positive responsive elements and mediates expression in small intestine and periphery while predominant liver and spleen expression is controlled by 5′-distal sequences. Cis-acting sequences mapped in transgenic mice. J Biol Chem 271:31831-31838, 1996

(25.) Gauthier B, Robb M, McPherson R: Cholesteryl ester transfer protein gene expression during differentiation of human preadipocytes to adipocytes in primary culture. Atherosclerosis 142:301-307, 1999

(26.) Brown MS, Goldstein JL: A proteolytic-pathway that controls the cholesterol content of membranes, cells, and blood. Proc Natl Acad Sci USA 96:11041-11048, 1999

(27.) Chouinard PA, Luo Y, Osborne TF, Walsh A, Tall AR: Sterol regulatory element binding protein-1 activates the cholesteryl ester transfer protein gene in vivo but is not required for sterol up-regulation of gene expression. J Bid Chem 273:22409-22414, 1998

(28.) Gauthier B, Robb M, Gaudet F, Ginsburg GS, McPherson R: Characterization of a cholesterol response element (CRE) in the promoter of the cholesteryl ester transfer protein gene: functional role of the transcription factors SREBP-la, -2, and YYI. J Lipid Res 40: 1284-1 293, 1999

Abbreviations: A10, atorvastatin 10 mg; A80, atorvastatin 80 mg; apo, apolipoprotein; CAD, coronary artery disease; CE, cholesteryl ester; CETP, CE transfer protein; CHD, coronary heart disease; FFA, free fatty acid; LpA-1, lipoprotein A-1; SREBP-1, sterol regulatory element binding protein-1; TC, total cholesterol; TG, triglyceride.

Francine V. van Venrooij, (1, 2) Ronald P. Stolk, (2) Jan-Dirk Banga, (1) Tjeerd P. Sijmonsma, (1) Arie van Tol, (3) D. Willem Erkelens, (1) Geesje M. Dallinga-Thie, (1)

From the (1) Department of Internal Medicine, University Medical Center Utrecht, Utrecht, the Netherlands; the (2) Julius Center for General Practice and Patient Oriented Research, University Medical Center Utrecht, Utrecht, the Netherlands; and the (3) Department of Biochemistry, Erasmus Medical Center, Rotterdam, the Netherlands.

* The members of the DALI study group are listed in the APPENDIX.

Address correspondence and reprint requests to G.M. Dallinga-Thie, University Medical Center Utrecht, Dept. of Internal Medicine, G 02.228, PO-Box 85500, 3508 GA Utrecht, The Netherlands. E-mail: g.m.dallingathie@azu.nl.

COPYRIGHT 2003 American Diabetes Association

COPYRIGHT 2003 Gale Group